ID: 965279461

View in Genome Browser
Species Human (GRCh38)
Location 3:166729773-166729795
Sequence GCTTACTTATGTGCAAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965279461_965279462 20 Left 965279461 3:166729773-166729795 CCATTACTTGCACATAAGTAAGC No data
Right 965279462 3:166729816-166729838 TTGTATACTGTAACAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965279461 Original CRISPR GCTTACTTATGTGCAAGTAA TGG (reversed) Intergenic
No off target data available for this crispr