ID: 965280585

View in Genome Browser
Species Human (GRCh38)
Location 3:166747312-166747334
Sequence ATGTGCGAATATAATAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965280585_965280587 -5 Left 965280585 3:166747312-166747334 CCCATCTTATTATATTCGCACAT No data
Right 965280587 3:166747330-166747352 CACATGCTGTCGCCTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965280585 Original CRISPR ATGTGCGAATATAATAAGAT GGG (reversed) Intergenic
No off target data available for this crispr