ID: 965287125

View in Genome Browser
Species Human (GRCh38)
Location 3:166830364-166830386
Sequence TATTATCCACACTTTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965287115_965287125 23 Left 965287115 3:166830318-166830340 CCTGGGCCTTAACAATAGTCCCA No data
Right 965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG No data
965287122_965287125 3 Left 965287122 3:166830338-166830360 CCAGGGAGTTTGGAGAAGGCAGG No data
Right 965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG No data
965287118_965287125 17 Left 965287118 3:166830324-166830346 CCTTAACAATAGTCCCAGGGAGT No data
Right 965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG No data
965287121_965287125 4 Left 965287121 3:166830337-166830359 CCCAGGGAGTTTGGAGAAGGCAG No data
Right 965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965287125 Original CRISPR TATTATCCACACTTTGAGGT AGG Intergenic
No off target data available for this crispr