ID: 965287791

View in Genome Browser
Species Human (GRCh38)
Location 3:166840583-166840605
Sequence GAACAAGGAGATACGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965287791_965287798 25 Left 965287791 3:166840583-166840605 CCAGCAATCGTATCTCCTTGTTC No data
Right 965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965287791 Original CRISPR GAACAAGGAGATACGATTGC TGG (reversed) Intergenic
No off target data available for this crispr