ID: 965287798

View in Genome Browser
Species Human (GRCh38)
Location 3:166840631-166840653
Sequence CAAACTCAGTGCAGCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965287792_965287798 10 Left 965287792 3:166840598-166840620 CCTTGTTCCCACTTTTAATCTCC No data
Right 965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG No data
965287794_965287798 2 Left 965287794 3:166840606-166840628 CCACTTTTAATCTCCAGCCATGC No data
Right 965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG No data
965287791_965287798 25 Left 965287791 3:166840583-166840605 CCAGCAATCGTATCTCCTTGTTC No data
Right 965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG No data
965287793_965287798 3 Left 965287793 3:166840605-166840627 CCCACTTTTAATCTCCAGCCATG No data
Right 965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965287798 Original CRISPR CAAACTCAGTGCAGCCTGAG TGG Intergenic
No off target data available for this crispr