ID: 965288324

View in Genome Browser
Species Human (GRCh38)
Location 3:166844837-166844859
Sequence TGCAATGGCAAGGATATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965288324_965288328 17 Left 965288324 3:166844837-166844859 CCTTGTATATCCTTGCCATTGCA No data
Right 965288328 3:166844877-166844899 ACCATTTCTGTTGTCTTCACTGG 0: 1
1: 0
2: 0
3: 17
4: 217
965288324_965288330 23 Left 965288324 3:166844837-166844859 CCTTGTATATCCTTGCCATTGCA No data
Right 965288330 3:166844883-166844905 TCTGTTGTCTTCACTGGATGAGG 0: 1
1: 0
2: 5
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965288324 Original CRISPR TGCAATGGCAAGGATATACA AGG (reversed) Intergenic
No off target data available for this crispr