ID: 965289704

View in Genome Browser
Species Human (GRCh38)
Location 3:166864561-166864583
Sequence GCTCCCAGGGGTGGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289704_965289722 29 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289704_965289713 1 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data
965289704_965289712 0 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289712 3:166864584-166864606 ATCCCCGGAGTTCGCCACCATGG No data
965289704_965289718 14 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289704_965289724 30 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289724 3:166864614-166864636 CCCCCGGCAGCCACCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289704 Original CRISPR GCTCCCAGGGGTGGGCTCCA GGG (reversed) Intergenic
No off target data available for this crispr