ID: 965289708

View in Genome Browser
Species Human (GRCh38)
Location 3:166864570-166864592
Sequence TCCGGGGATGCTCCCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289708_965289726 22 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289726 3:166864615-166864637 CCCCGGCAGCCACCATGATGGGG No data
965289708_965289724 21 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289724 3:166864614-166864636 CCCCCGGCAGCCACCATGATGGG No data
965289708_965289722 20 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289708_965289718 5 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289708_965289712 -9 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289712 3:166864584-166864606 ATCCCCGGAGTTCGCCACCATGG No data
965289708_965289713 -8 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289708 Original CRISPR TCCGGGGATGCTCCCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr