ID: 965289711

View in Genome Browser
Species Human (GRCh38)
Location 3:166864575-166864597
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289711_965289726 17 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289726 3:166864615-166864637 CCCCGGCAGCCACCATGATGGGG No data
965289711_965289722 15 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289711_965289718 0 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289711_965289724 16 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289724 3:166864614-166864636 CCCCCGGCAGCCACCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289711 Original CRISPR CGAACTCCGGGGATGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr