ID: 965289713

View in Genome Browser
Species Human (GRCh38)
Location 3:166864585-166864607
Sequence TCCCCGGAGTTCGCCACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289705_965289713 0 Left 965289705 3:166864562-166864584 CCTGGAGCCCACCCCTGGGAGCA No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data
965289704_965289713 1 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data
965289706_965289713 -7 Left 965289706 3:166864569-166864591 CCCACCCCTGGGAGCATCCCCGG No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data
965289708_965289713 -8 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289713 3:166864585-166864607 TCCCCGGAGTTCGCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289713 Original CRISPR TCCCCGGAGTTCGCCACCAT GGG Intergenic
No off target data available for this crispr