ID: 965289714

View in Genome Browser
Species Human (GRCh38)
Location 3:166864586-166864608
Sequence TCCCATGGTGGCGAACTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289714_965289733 30 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289733 3:166864639-166864661 CAGACCTAGCTGCCTGCGGCAGG No data
965289714_965289724 5 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289724 3:166864614-166864636 CCCCCGGCAGCCACCATGATGGG No data
965289714_965289731 26 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289731 3:166864635-166864657 GGGCCAGACCTAGCTGCCTGCGG No data
965289714_965289722 4 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289714_965289726 6 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289726 3:166864615-166864637 CCCCGGCAGCCACCATGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289714 Original CRISPR TCCCATGGTGGCGAACTCCG GGG (reversed) Intergenic
No off target data available for this crispr