ID: 965289718

View in Genome Browser
Species Human (GRCh38)
Location 3:166864598-166864620
Sequence CCACCATGGGAACCCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289705_965289718 13 Left 965289705 3:166864562-166864584 CCTGGAGCCCACCCCTGGGAGCA No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289709_965289718 2 Left 965289709 3:166864573-166864595 CCCCTGGGAGCATCCCCGGAGTT No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289711_965289718 0 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289708_965289718 5 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289706_965289718 6 Left 965289706 3:166864569-166864591 CCCACCCCTGGGAGCATCCCCGG No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289710_965289718 1 Left 965289710 3:166864574-166864596 CCCTGGGAGCATCCCCGGAGTTC No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
965289704_965289718 14 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289718 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289718 Original CRISPR CCACCATGGGAACCCACCCC CGG Intergenic
No off target data available for this crispr