ID: 965289719

View in Genome Browser
Species Human (GRCh38)
Location 3:166864601-166864623
Sequence CTGCCGGGGGTGGGTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289719_965289724 -10 Left 965289719 3:166864601-166864623 CCATGGGAACCCACCCCCGGCAG No data
Right 965289724 3:166864614-166864636 CCCCCGGCAGCCACCATGATGGG No data
965289719_965289726 -9 Left 965289719 3:166864601-166864623 CCATGGGAACCCACCCCCGGCAG No data
Right 965289726 3:166864615-166864637 CCCCGGCAGCCACCATGATGGGG No data
965289719_965289731 11 Left 965289719 3:166864601-166864623 CCATGGGAACCCACCCCCGGCAG No data
Right 965289731 3:166864635-166864657 GGGCCAGACCTAGCTGCCTGCGG No data
965289719_965289733 15 Left 965289719 3:166864601-166864623 CCATGGGAACCCACCCCCGGCAG No data
Right 965289733 3:166864639-166864661 CAGACCTAGCTGCCTGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289719 Original CRISPR CTGCCGGGGGTGGGTTCCCA TGG (reversed) Intergenic
No off target data available for this crispr