ID: 965289722

View in Genome Browser
Species Human (GRCh38)
Location 3:166864613-166864635
Sequence ACCCCCGGCAGCCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965289705_965289722 28 Left 965289705 3:166864562-166864584 CCTGGAGCCCACCCCTGGGAGCA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289714_965289722 4 Left 965289714 3:166864586-166864608 CCCCGGAGTTCGCCACCATGGGA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289706_965289722 21 Left 965289706 3:166864569-166864591 CCCACCCCTGGGAGCATCCCCGG No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289715_965289722 3 Left 965289715 3:166864587-166864609 CCCGGAGTTCGCCACCATGGGAA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289708_965289722 20 Left 965289708 3:166864570-166864592 CCACCCCTGGGAGCATCCCCGGA No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289709_965289722 17 Left 965289709 3:166864573-166864595 CCCCTGGGAGCATCCCCGGAGTT No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289704_965289722 29 Left 965289704 3:166864561-166864583 CCCTGGAGCCCACCCCTGGGAGC No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289710_965289722 16 Left 965289710 3:166864574-166864596 CCCTGGGAGCATCCCCGGAGTTC No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289716_965289722 2 Left 965289716 3:166864588-166864610 CCGGAGTTCGCCACCATGGGAAC No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289711_965289722 15 Left 965289711 3:166864575-166864597 CCTGGGAGCATCCCCGGAGTTCG No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data
965289717_965289722 -8 Left 965289717 3:166864598-166864620 CCACCATGGGAACCCACCCCCGG No data
Right 965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965289722 Original CRISPR ACCCCCGGCAGCCACCATGA TGG Intergenic
No off target data available for this crispr