ID: 965291739

View in Genome Browser
Species Human (GRCh38)
Location 3:166889570-166889592
Sequence CAGCTGTTACTGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965291739_965291743 13 Left 965291739 3:166889570-166889592 CCACCAAAGCCCAGTAACAGCTG No data
Right 965291743 3:166889606-166889628 GAGTAGTTATATGCAGAAGATGG No data
965291739_965291745 18 Left 965291739 3:166889570-166889592 CCACCAAAGCCCAGTAACAGCTG No data
Right 965291745 3:166889611-166889633 GTTATATGCAGAAGATGGCAGGG No data
965291739_965291744 17 Left 965291739 3:166889570-166889592 CCACCAAAGCCCAGTAACAGCTG No data
Right 965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965291739 Original CRISPR CAGCTGTTACTGGGCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr