ID: 965291744

View in Genome Browser
Species Human (GRCh38)
Location 3:166889610-166889632
Sequence AGTTATATGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965291741_965291744 8 Left 965291741 3:166889579-166889601 CCCAGTAACAGCTGTCTCTCAAA No data
Right 965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG No data
965291739_965291744 17 Left 965291739 3:166889570-166889592 CCACCAAAGCCCAGTAACAGCTG No data
Right 965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG No data
965291742_965291744 7 Left 965291742 3:166889580-166889602 CCAGTAACAGCTGTCTCTCAAAA No data
Right 965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG No data
965291740_965291744 14 Left 965291740 3:166889573-166889595 CCAAAGCCCAGTAACAGCTGTCT No data
Right 965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965291744 Original CRISPR AGTTATATGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr