ID: 965294501 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:166926352-166926374 |
| Sequence | CTAGACCTGTACACTACTAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965294497_965294501 | 21 | Left | 965294497 | 3:166926308-166926330 | CCTGCTACTACAGGCTTTCTGTT | No data | ||
| Right | 965294501 | 3:166926352-166926374 | CTAGACCTGTACACTACTACAGG | No data | ||||
| 965294496_965294501 | 22 | Left | 965294496 | 3:166926307-166926329 | CCCTGCTACTACAGGCTTTCTGT | No data | ||
| Right | 965294501 | 3:166926352-166926374 | CTAGACCTGTACACTACTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965294501 | Original CRISPR | CTAGACCTGTACACTACTAC AGG | Intergenic | ||