ID: 965294501

View in Genome Browser
Species Human (GRCh38)
Location 3:166926352-166926374
Sequence CTAGACCTGTACACTACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965294497_965294501 21 Left 965294497 3:166926308-166926330 CCTGCTACTACAGGCTTTCTGTT No data
Right 965294501 3:166926352-166926374 CTAGACCTGTACACTACTACAGG No data
965294496_965294501 22 Left 965294496 3:166926307-166926329 CCCTGCTACTACAGGCTTTCTGT No data
Right 965294501 3:166926352-166926374 CTAGACCTGTACACTACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965294501 Original CRISPR CTAGACCTGTACACTACTAC AGG Intergenic