ID: 965298792

View in Genome Browser
Species Human (GRCh38)
Location 3:166984146-166984168
Sequence CTGTTGAAGTGAAAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965298786_965298792 28 Left 965298786 3:166984095-166984117 CCCAAGCCTCATAATTTTGTCAG No data
Right 965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG No data
965298790_965298792 22 Left 965298790 3:166984101-166984123 CCTCATAATTTTGTCAGCTGGGA No data
Right 965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG No data
965298787_965298792 27 Left 965298787 3:166984096-166984118 CCAAGCCTCATAATTTTGTCAGC No data
Right 965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965298792 Original CRISPR CTGTTGAAGTGAAAGTTGTC AGG Intergenic
No off target data available for this crispr