ID: 965300147

View in Genome Browser
Species Human (GRCh38)
Location 3:166998247-166998269
Sequence GTCAGAGGGGACCAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965300147_965300154 -8 Left 965300147 3:166998247-166998269 CCATCACCCTGGTCCCCTCTGAC No data
Right 965300154 3:166998262-166998284 CCTCTGACAAGACCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965300147 Original CRISPR GTCAGAGGGGACCAGGGTGA TGG (reversed) Intergenic
No off target data available for this crispr