ID: 965302009

View in Genome Browser
Species Human (GRCh38)
Location 3:167017489-167017511
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1228
Summary {0: 11, 1: 5, 2: 11, 3: 298, 4: 903}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965302009_965302022 26 Left 965302009 3:167017489-167017511 CCCTCCACGGTCTCCCTCTCCCT 0: 11
1: 5
2: 11
3: 298
4: 903
Right 965302022 3:167017538-167017560 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
965302009_965302014 -5 Left 965302009 3:167017489-167017511 CCCTCCACGGTCTCCCTCTCCCT 0: 11
1: 5
2: 11
3: 298
4: 903
Right 965302014 3:167017507-167017529 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965302009 Original CRISPR AGGGAGAGGGAGACCGTGGA GGG (reversed) Intergenic
900303548 1:1990369-1990391 CGGGAGAGGGAGACAGTGGCGGG + Intronic
900498018 1:2985197-2985219 GGGCTGAGGGAGACCCTGGAAGG + Intergenic
900562671 1:3315180-3315202 AGGGAGAGGGAGAGGGAGGGTGG - Intronic
900569579 1:3351704-3351726 AGGGAGGGGGAGACAGAGGAAGG - Intronic
900651547 1:3732456-3732478 AGGGACATGGAGACCAAGGAGGG + Intronic
900669671 1:3843246-3843268 ACAGAGAGGGTGACCGAGGATGG + Intronic
900847075 1:5112502-5112524 AGGGAGAGGGAGGGAGAGGAAGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901787075 1:11631847-11631869 AGAGAGAGAGAGAAAGTGGAAGG + Intergenic
902018440 1:13327503-13327525 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018446 1:13327522-13327544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018452 1:13327541-13327563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018458 1:13327560-13327582 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018464 1:13327579-13327601 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018470 1:13327598-13327620 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018476 1:13327617-13327639 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018482 1:13327636-13327658 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018488 1:13327655-13327677 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902646038 1:17798498-17798520 TGGGAGAGGGAGTTGGTGGAGGG + Intronic
902652929 1:17848399-17848421 AGGGGGAGTTAGACCATGGATGG - Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903147868 1:21387055-21387077 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
903163152 1:21503477-21503499 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903638148 1:24834799-24834821 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638154 1:24834818-24834840 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638160 1:24834837-24834859 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638166 1:24834856-24834878 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638170 1:24834869-24834891 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638176 1:24834888-24834910 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638180 1:24834901-24834923 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638188 1:24834926-24834948 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638194 1:24834945-24834967 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638198 1:24834958-24834980 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638204 1:24834977-24834999 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903921802 1:26804853-26804875 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921808 1:26804872-26804894 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921814 1:26804891-26804913 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903970740 1:27117317-27117339 AGGGGCAGGGAGGCTGTGGAGGG - Intronic
904037851 1:27568485-27568507 AGGGGCGGGGAGACCGTTGAAGG - Intronic
904237875 1:29125584-29125606 TGGGAAAGGGAGAACGTGGCTGG - Intergenic
904635851 1:31880502-31880524 AGAGAGAGAGAGACAGTGGCAGG + Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904831985 1:33311311-33311333 AGGGAACAGGTGACCGTGGAGGG - Intronic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905360881 1:37419558-37419580 AGGGAGAGGATCACAGTGGAGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907018729 1:51043916-51043938 AGGGAGAGAGAGAAAGTGAAAGG + Intergenic
907042017 1:51269856-51269878 AGGGAAAGGGAGCCCTGGGAGGG - Intronic
907359442 1:53902995-53903017 AGGGGCAGGGAGGCTGTGGAAGG - Intronic
907379777 1:54076927-54076949 AGGGGGATGGGGAACGTGGATGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908554932 1:65248389-65248411 GGAGAGTGGGAGACCCTGGAAGG + Intronic
908800894 1:67879634-67879656 AGGGAAAGGGAGAGAGAGGAAGG - Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
910523298 1:88148510-88148532 AGGGAGAGGGAGGGAGGGGAGGG + Intergenic
912716980 1:111989911-111989933 CGGGAGAGGCAGCCCGTGGCCGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912823515 1:112885796-112885818 AGGAACAGGGAGACTGTGGGTGG + Intergenic
913133455 1:115863960-115863982 AGGGAGTGGGAGTCTGTGGCTGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915310021 1:155002055-155002077 AAGGAGAGGGAGCCCCTGTAGGG + Intergenic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
915955197 1:160215025-160215047 AGGGAAAGGGAGACTTGGGAAGG - Exonic
916166380 1:161970300-161970322 AGGGAGAGGGAGCCGGGAGAAGG + Intergenic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916414047 1:164576441-164576463 CGGGAGAGGGAGCCGGTGCAAGG - Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917848617 1:179041679-179041701 AGGGAGAGGGAGACGGGAGACGG + Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918388742 1:184036988-184037010 AGGGCGAGGGAGCCGCTGGAGGG - Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919926066 1:202192488-202192510 AGGGAGAGGGAGAGCGAGAGCGG + Intergenic
920867494 1:209765212-209765234 AGGGAGAGAGAGAGAGAGGAAGG + Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921833995 1:219759366-219759388 AGGGAGAGAGAGAGGGAGGAGGG + Intronic
922306689 1:224350665-224350687 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922548269 1:226474669-226474691 AGGAGGAGGGAAACCCTGGAAGG + Intergenic
922662628 1:227443535-227443557 AGGGAGAGGGAGAGGGAAGATGG - Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923498112 1:234542363-234542385 AGGGAGAGTGGGACAGTGGCAGG - Intergenic
923755847 1:236790640-236790662 AGGGAGAGCGAGACCTTCCAGGG + Intergenic
923841027 1:237670295-237670317 GGGGAGAGGGAGACTGGAGAGGG + Intronic
923841037 1:237670326-237670348 AGGGAGAGGGAGACGGGAGAGGG + Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924262893 1:242250373-242250395 AGAGAGAGGGAAGCCCTGGAAGG + Intronic
924334833 1:242977105-242977127 AGGGACAGGGAGAAAATGGAAGG + Intergenic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
924925469 1:248676275-248676297 AGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063114975 10:3067056-3067078 GGGGCGAGGGAGACCGTGAGTGG - Intronic
1063117895 10:3084952-3084974 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063117905 10:3084976-3084998 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063117915 10:3085000-3085022 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063117925 10:3085024-3085046 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063117935 10:3085048-3085070 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063117945 10:3085072-3085094 AGGGAGTGGGGGACCGTGCTGGG - Intronic
1063153136 10:3354936-3354958 AGGCAGAGGGAGCCAGAGGAAGG - Intergenic
1063160078 10:3412636-3412658 TGGGAAAGTGAGACCGTGCAGGG - Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1063876500 10:10484251-10484273 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1063876509 10:10484274-10484296 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064688193 10:17886347-17886369 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1065152859 10:22840002-22840024 AGTGGGAGTGAGACAGTGGAGGG + Intergenic
1065178097 10:23097887-23097909 AGAGAGAGGGAGACATTGGGAGG + Intronic
1065289336 10:24214458-24214480 AAAGAGAGAGAGAACGTGGAAGG + Intronic
1065319724 10:24498133-24498155 AGGGTGCGGGAGACCTTGGTGGG + Intronic
1065840144 10:29695798-29695820 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840148 10:29695811-29695833 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840154 10:29695830-29695852 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840162 10:29695855-29695877 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840168 10:29695874-29695896 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840174 10:29695893-29695915 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840180 10:29695912-29695934 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840192 10:29695949-29695971 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1066085112 10:31968968-31968990 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085118 10:31968987-31969009 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085124 10:31969006-31969028 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085130 10:31969025-31969047 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085136 10:31969044-31969066 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085142 10:31969063-31969085 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085148 10:31969082-31969104 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085154 10:31969101-31969123 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066199042 10:33128124-33128146 AGGGAGGGGAAGAGGGTGGAGGG - Intergenic
1066336231 10:34481233-34481255 AGGGAGAGGGAAAGGGAGGAGGG - Intronic
1066379670 10:34890555-34890577 AGGTAGAGGGAGTCCCTGTAGGG + Intergenic
1066721893 10:38348081-38348103 AGAGAGAGGGAAGCCCTGGAAGG - Intergenic
1066728907 10:38419098-38419120 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067091578 10:43268297-43268319 AGGGAGAGGGAGCCAGCGAAGGG + Intergenic
1067339593 10:45391045-45391067 AGGGAGAGGGAGAGGGGAGAGGG - Intronic
1067344269 10:45426755-45426777 AGCGAGAGAGAGACAGTGCAGGG - Intronic
1067455830 10:46418717-46418739 AGGGAGACGGTGATCATGGAGGG - Intergenic
1067575219 10:47404468-47404490 TGGGAGAGGGAGACCTAGGTGGG + Intergenic
1067631370 10:47965922-47965944 AGGGAGACGGTGATCATGGAGGG + Intergenic
1068324353 10:55464958-55464980 AAGAAGAGGGAGACCTTGAAAGG + Intronic
1068846437 10:61680960-61680982 AGAGAGAGAGAGAACGAGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069620381 10:69833870-69833892 TTGGGGAGGCAGACCGTGGAGGG + Intronic
1069717455 10:70530112-70530134 AGGGAGAGGGGCACCTTGGAGGG + Intronic
1069803538 10:71100711-71100733 AGGGAGAGTGAGACGGAGGGAGG - Intergenic
1069926569 10:71854785-71854807 AGGGAGAGGGACAGGGTGGAGGG - Intergenic
1070586049 10:77767115-77767137 TTGGAGAGGGATACAGTGGATGG - Intergenic
1070598590 10:77849728-77849750 AGGGAGAGGGGGACAGGGGTGGG + Intronic
1070766853 10:79061698-79061720 GTGGAGAGGGTGTCCGTGGAGGG + Intergenic
1071289920 10:84181200-84181222 AGGGAGAGGGAGAGGGAGAAGGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071600019 10:86954471-86954493 AGGGAGAGGGAGCCTGTGGGAGG + Intronic
1072180135 10:92974548-92974570 GGGGAGAGGGAGACGGGAGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1072999458 10:100276340-100276362 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999462 10:100276353-100276375 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999466 10:100276366-100276388 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999470 10:100276379-100276401 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999476 10:100276398-100276420 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999482 10:100276417-100276439 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999488 10:100276436-100276458 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999494 10:100276455-100276477 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999500 10:100276474-100276496 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999508 10:100276499-100276521 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1074334374 10:112554786-112554808 AGGGAGAGGTAGAGAGTGGGAGG - Intronic
1074757334 10:116634290-116634312 AGGGACAGAGAGCCGGTGGAGGG - Intronic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1074942416 10:118248360-118248382 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
1075170734 10:120111428-120111450 AGGGAGAAGGAGACAGTGAATGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075753314 10:124791613-124791635 AGGGACAGGGAGACCCTCGGGGG - Intronic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076371604 10:129959299-129959321 AGGGCGAGGGAGGCCGGGGCCGG + Intronic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076402622 10:130193785-130193807 AGTGTGAGGGAGGCAGTGGAAGG - Intergenic
1076738296 10:132468411-132468433 AAGGAGAGGGAGTTCGGGGAGGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077615483 11:3670833-3670855 GGGGAAAGGGAGACAGTGAAGGG - Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077719750 11:4616079-4616101 AGGGAGGGGGAGAGAGGGGAAGG - Intergenic
1077733852 11:4766765-4766787 AGAGAGAGAGAAACCGTGGGAGG - Intronic
1077765661 11:5157127-5157149 AGGGAGAGAGAGAGAGTGGGAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078565458 11:12410347-12410369 GGGGAAAGGCAGACCTTGGAGGG - Intronic
1078876946 11:15408691-15408713 AGAGAGAGGCAGACACTGGAGGG + Intergenic
1079080544 11:17410663-17410685 AGGGAGAGGAAGAGAGTAGAGGG + Intronic
1079822523 11:25148412-25148434 AGGGAGAGGGATAGAGGGGAGGG + Intergenic
1080313556 11:30923027-30923049 AGGGAGGGAGAGACGGAGGAAGG + Intronic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080843206 11:36003890-36003912 AGGGAGAGAGAGAGAGTGAAGGG + Intronic
1081540639 11:44032239-44032261 ATGTAGAGAGAGACCCTGGAAGG - Intergenic
1081578586 11:44335214-44335236 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083611865 11:64008199-64008221 AGGGAGAGGCAAAGCGTGGAGGG + Intronic
1083831841 11:65238548-65238570 AGGGAGAGGGAGAGGGAGAATGG - Intergenic
1083865259 11:65450316-65450338 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865263 11:65450329-65450351 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865267 11:65450342-65450364 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865273 11:65450361-65450383 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865279 11:65450380-65450402 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1084511869 11:69610862-69610884 AGGGAGAGGGGGAACAAGGAAGG + Intergenic
1084742831 11:71150260-71150282 AGGGAGAGGGAGGGAGAGGAAGG + Intronic
1085048067 11:73364658-73364680 AGGGAGATGGAGACCATGGTAGG + Intronic
1085116894 11:73937671-73937693 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116904 11:73937702-73937724 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116910 11:73937721-73937743 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085139882 11:74130134-74130156 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1085159498 11:74327793-74327815 AGGGAGAGGGAGAGGGAGCAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085508674 11:77074383-77074405 AGGGAGAGGGAAAAGGTGGGAGG - Intronic
1085754201 11:79190776-79190798 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754209 11:79190801-79190823 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754215 11:79190820-79190842 AGGGAGAGGGAGAAGGGAGAGGG - Intronic
1085754221 11:79190839-79190861 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754227 11:79190858-79190880 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754233 11:79190877-79190899 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754239 11:79190896-79190918 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754245 11:79190915-79190937 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754251 11:79190934-79190956 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754260 11:79190960-79190982 AGGGAGAGGGAGACGGGAGACGG - Intronic
1085754265 11:79190979-79191001 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754271 11:79190998-79191020 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754277 11:79191017-79191039 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754283 11:79191036-79191058 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754289 11:79191055-79191077 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754295 11:79191074-79191096 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754303 11:79191099-79191121 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754311 11:79191124-79191146 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086663983 11:89457137-89457159 GGGGAGAGGGAGACTGTAGTGGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087646559 11:100814664-100814686 AGGGAGAGAGAGATAGGGGAGGG + Intronic
1088031923 11:105261983-105262005 AGGGAGGAAGAGACGGTGGAAGG + Intergenic
1088042659 11:105406482-105406504 AGGGAGAGGGAGAGAATGGGTGG + Intergenic
1089064275 11:115650580-115650602 AAGGGGAGGGGGACGGTGGATGG - Intergenic
1089077930 11:115753542-115753564 AGGGAGAGTGAGGCCAGGGAAGG + Intergenic
1089145617 11:116327834-116327856 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089583861 11:119497756-119497778 AGGGTGAGCGGGACCCTGGAAGG + Intergenic
1090077425 11:123588043-123588065 AGGGAAAGGGAGACTGAGGCAGG - Intronic
1090227482 11:125080445-125080467 AAGGAGTGGGAGACCTTGGATGG - Intronic
1090489789 11:127148818-127148840 AGAGAGAGAGAGACCATTGAGGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090879384 11:130820401-130820423 AAGGACAGGGAGACCATGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091155555 11:133368278-133368300 AGGGAGAGGGAGAGGAGGGAAGG + Intronic
1091219085 11:133919946-133919968 TGGGAGGGGGAGCCTGTGGACGG + Exonic
1091324179 11:134671763-134671785 AGGGAGGGAGAGAGAGTGGAGGG + Intergenic
1091378391 12:41237-41259 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378397 12:41256-41278 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378403 12:41275-41297 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091741844 12:2964795-2964817 AGGCAGAGCGAGACAGTGGGTGG + Intronic
1092167840 12:6353982-6354004 AGAGAGAGGGAGGCCGAGGCGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094025943 12:25959293-25959315 AGGGAGCGGGAGCCCGCGGCGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094708784 12:32940708-32940730 AGAGAGAGAGAGAGAGTGGAGGG - Intergenic
1096029214 12:48397078-48397100 AGGGAAAGGGAGACTGTTAATGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096382752 12:51172860-51172882 AGAGAGAGCGAGACCTGGGAGGG - Exonic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096578522 12:52569719-52569741 TGGGAAAGGGAGACTGTGGGTGG + Intronic
1096607221 12:52775433-52775455 GGGGAGAGGGGGAACCTGGAGGG - Exonic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1097194671 12:57236820-57236842 AGGGTGAGGGAGACCATGCCAGG - Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097854857 12:64451933-64451955 AGGGCGAGGGCAACAGTGGACGG + Exonic
1097882203 12:64696126-64696148 AGGGAGAGGGAGAGAGAGGGAGG - Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098774058 12:74588940-74588962 AGGGAGAGGGGGACGGGGGGAGG + Intergenic
1100570926 12:95842354-95842376 AGGGAGAGGGAGACGGGAAAGGG + Intergenic
1100570932 12:95842373-95842395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570938 12:95842392-95842414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570944 12:95842411-95842433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570950 12:95842430-95842452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570956 12:95842449-95842471 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570962 12:95842468-95842490 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570968 12:95842487-95842509 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570974 12:95842506-95842528 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100717503 12:97321577-97321599 AGGGTGAGGGAGACGATGGCAGG + Intergenic
1101266399 12:103092904-103092926 GGGAAGAGGGAGACCCAGGATGG - Intergenic
1101641815 12:106591157-106591179 AGGGAGAGGGTGGCAGTGGGAGG + Intronic
1101672890 12:106893122-106893144 AGGGGGAGGGAGACAGGAGATGG + Intergenic
1101884262 12:108648191-108648213 AGGGAGAGGAGGTCCCTGGAAGG - Intronic
1101920617 12:108929671-108929693 AGGGTGGGGGAGTCAGTGGATGG - Intronic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102592506 12:113967427-113967449 AGGGAGAGGGAGGAATTGGAAGG - Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102598752 12:114012907-114012929 AGGGAGAGGGAGAGGGAGGTGGG + Intergenic
1102598820 12:114013120-114013142 AGGGAGATGGAGAGAGGGGAGGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102712258 12:114938602-114938624 AGGGGGAGGAAGATCGAGGAGGG + Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103519451 12:121528188-121528210 TGGAAGAGGAAGACCGTTGAAGG - Intronic
1103599102 12:122043076-122043098 AGGGAGAGAGAGACAGCGGGAGG - Intronic
1104521518 12:129480200-129480222 AGGGAGAGGAAGAAGGTGCATGG + Intronic
1104873144 12:132014923-132014945 ACAGAGAGGGAGACCCAGGACGG - Intronic
1104958036 12:132475344-132475366 AGGGGGAGGGGCACCGCGGAGGG - Intergenic
1105319966 13:19310089-19310111 GGGGAGAGGGAAAGCGGGGATGG - Intergenic
1105434846 13:20367584-20367606 AGGGAGAGGGAGCCAGTGCCAGG + Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1105527264 13:21187423-21187445 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1106174803 13:27321034-27321056 TGGGAGAGGGCGGCTGTGGATGG + Intergenic
1106457990 13:29944303-29944325 AGGGAGAGGGTGCCCTTGGCTGG + Intergenic
1106679970 13:31999469-31999491 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1106679976 13:31999488-31999510 GGGGAGAGGGAGACTGGAGAGGG - Intergenic
1106871810 13:34029796-34029818 AGGGAGAGGGAGAGGGTAGCAGG + Intergenic
1107100352 13:36583599-36583621 AGGGATGGAGAGACCATGGAGGG - Intergenic
1107388977 13:39943522-39943544 AGGGTGAGGGAGGAAGTGGAAGG + Intergenic
1107562504 13:41571274-41571296 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562508 13:41571287-41571309 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107562519 13:41571319-41571341 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562525 13:41571338-41571360 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107634924 13:42382268-42382290 AGAGGAAGGGAGACCGTTGAAGG + Intergenic
1107865884 13:44702998-44703020 AGGGAGAGAGAGAGAGAGGAAGG - Intergenic
1107888523 13:44894260-44894282 AGAGAGAGGGAGAGCGAGGGAGG - Intergenic
1108103528 13:46983675-46983697 AGGGAGAGAGGGACCTTGTATGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1112401935 13:99085826-99085848 AAGGAGAGGGAGGCCGGGGGAGG + Intronic
1112550709 13:100417985-100418007 AGGGAGAGGGATACAGGGAAGGG - Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113116035 13:106875774-106875796 AGTGAGAGGAAGCCTGTGGAGGG + Intergenic
1113464904 13:110506251-110506273 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113464911 13:110506300-110506322 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113672305 13:112183382-112183404 AGGGAAAGGGAGACCGTGCCCGG + Intergenic
1113710608 13:112461907-112461929 AGGGAGGGGGAGGGGGTGGAGGG + Intergenic
1113862189 13:113494329-113494351 TGGGAAACCGAGACCGTGGAAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115616668 14:35102008-35102030 AGAGAGAGAGAAACCATGGAAGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116192223 14:41675605-41675627 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1117212206 14:53512435-53512457 AGGGAGAGGTAGACAGTGAGAGG + Intergenic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118341420 14:64896659-64896681 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341426 14:64896678-64896700 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341432 14:64896697-64896719 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341438 14:64896716-64896738 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341444 14:64896735-64896757 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341450 14:64896754-64896776 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341456 14:64896773-64896795 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341462 14:64896792-64896814 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1119601838 14:75981915-75981937 AGGGAGAGGGAGAGAGAGAAAGG - Intronic
1119619097 14:76118269-76118291 AGGGCGAGGGAGTCCGGGGTTGG + Intergenic
1120193926 14:81463172-81463194 AGGGAGAGGGAGATGGGAGAGGG + Intergenic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120290466 14:82563640-82563662 AGGAAGAGGGAGACAGCGGGAGG + Intergenic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1121592303 14:95125535-95125557 AGGGAGAGGGAGAAGGTCGGGGG + Intronic
1121800340 14:96769182-96769204 AGGGAGAGAGGGACAGAGGAAGG - Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122690005 14:103527800-103527822 AGAGAGTGGGAGGCCATGGAAGG + Intergenic
1122833986 14:104422058-104422080 AGGGAGAGGGAGAGGGAGTAGGG - Intergenic
1123046838 14:105521624-105521646 AGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1202891245 14_KI270722v1_random:160069-160091 AGGGAGATGGAGACAGGAGAAGG + Intergenic
1123539304 15:21272202-21272224 AGGGAGAGAGGGAGCGAGGAAGG - Intergenic
1124065117 15:26335269-26335291 AGGGTGAGGGCGATCATGGAAGG + Intergenic
1124099720 15:26682278-26682300 AGGGAGTGGGAGAGGGAGGAAGG - Intronic
1124218900 15:27832437-27832459 CGGGGGAGGGAGACTGTAGATGG - Intronic
1124390483 15:29251177-29251199 AGGCAGAGGGCAACTGTGGAGGG + Intronic
1125918508 15:43510448-43510470 AAGGACAGGGAAACCGAGGATGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127292988 15:57586749-57586771 AGGGAGTGGGAGACCCAGGGAGG - Intergenic
1127328439 15:57916986-57917008 GGGGAGAAGGAAAGCGTGGAGGG + Intergenic
1127332273 15:57950828-57950850 AGGGAGAGAGGGAGGGTGGAAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1128223233 15:65983074-65983096 AGGGAGATGGAGCCAGGGGAGGG - Intronic
1128643372 15:69357047-69357069 AGAGAGAGAGAGACAGTGGGTGG - Intronic
1129082363 15:73052322-73052344 AGGGGGGCGGAGACCGCGGACGG - Intronic
1129121125 15:73397419-73397441 AGGGAGATGAAGACCCTGCAAGG + Intergenic
1129306427 15:74667449-74667471 GGGGAGAGGGAGGGGGTGGAGGG + Intronic
1129429678 15:75490512-75490534 AGAGAGAGGGAGACCAGGCATGG + Intronic
1129708915 15:77810381-77810403 AGGGAGAGGGACAGCGAGGAGGG + Intronic
1129798397 15:78395372-78395394 TGGGAGAGGCAAACCCTGGATGG + Intergenic
1129849516 15:78784393-78784415 AGGGAGAGGAAGAGGGGGGAGGG + Intronic
1130012909 15:80165808-80165830 AAGGAGAGTGAGACCAGGGAGGG + Intronic
1130856038 15:87840885-87840907 AGGGAGGGGGAGAGGGAGGAGGG + Intergenic
1131473926 15:92720070-92720092 AGGGTGAGGGATACATTGGAAGG + Intronic
1131479552 15:92769334-92769356 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131479579 15:92769422-92769444 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1132119350 15:99163279-99163301 ATGGAGAGGGATATAGTGGAAGG + Intronic
1132158337 15:99513267-99513289 GGGGAGAAGGATACTGTGGATGG + Intergenic
1132346897 15:101114015-101114037 AGGGAGAAGGAGAGCATGGGAGG - Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133392703 16:5422600-5422622 AGGAAGAGTGAGAGGGTGGAGGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133417296 16:5616569-5616591 AGGGAGAGGGAGAAGGGAGAGGG - Intergenic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133606339 16:7391785-7391807 AGGAAGAGTGAGTCGGTGGATGG + Intronic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1134239925 16:12498052-12498074 AGGGAAAGAGAGACTGGGGAAGG + Intronic
1134316963 16:13127435-13127457 AGGGAGAGAGAGATCGAGGGAGG + Intronic
1135146890 16:19970407-19970429 AGGGAGAGAGAGAGCATGAAGGG - Intergenic
1135166425 16:20143050-20143072 AGGGAGTGGGGGAAAGTGGAAGG + Intergenic
1135173504 16:20207917-20207939 AGGGACAGAGAGACTCTGGATGG + Intergenic
1135277631 16:21127210-21127232 AGGCAGAGGGAGACCAGGCATGG + Intronic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1136479103 16:30530620-30530642 AGGGAGAGAGAGACCACGGTGGG + Intronic
1136482721 16:30552681-30552703 AAGGAGAGAGAGACCTTGGTGGG + Intronic
1136543628 16:30943007-30943029 AGGGAGCTGGAGACCCTGGCAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138179117 16:54930592-54930614 AGAGAGGGAGAGACCGGGGAGGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139370011 16:66461177-66461199 GGGGACAGGGAGACCGGGGGTGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140315003 16:73888072-73888094 AGGGAGAGGAAGACGGAGGTGGG - Intergenic
1140805813 16:78531245-78531267 AGGGACAGTGAGAGCGAGGAAGG + Intronic
1141165148 16:81655332-81655354 AGGCAGAGGGGCATCGTGGAGGG + Intronic
1141453247 16:84119788-84119810 AGGCAGAGGAAGACCCTGGGTGG + Intergenic
1141853705 16:86666341-86666363 AGGGAGTGGGAAAGCGTGGAAGG + Intergenic
1141976084 16:87517533-87517555 AGGGAGAGAGTGACCCTGGTTGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142045762 16:87924343-87924365 AAGGAGAGAGAGACACTGGAAGG + Intronic
1142234526 16:88915492-88915514 ATGGACGGGGAGAGCGTGGACGG + Intronic
1142241373 16:88948378-88948400 TGGGAGAGGGTGACTGTGCAGGG + Intronic
1142399250 16:89850669-89850691 TGGGTGGGGGCGACCGTGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143091272 17:4450324-4450346 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1143091282 17:4450350-4450372 AGGGAGAGAGAGAGAGAGGAGGG - Intronic
1143273189 17:5690605-5690627 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
1143277380 17:5721922-5721944 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143660963 17:8324416-8324438 AGAGGGAGGGAGACCTTGGTGGG - Intergenic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1144210928 17:13014905-13014927 AGGCAGAGGGAACCCGCGGAAGG + Intronic
1144713729 17:17420215-17420237 AGGGAGAGAGGGACAGTGGGAGG + Intergenic
1144883764 17:18444400-18444422 AGGGGGTGGGAGACTGTGGGAGG - Intergenic
1144942226 17:18949725-18949747 AGGCAGAGAGAGGCCCTGGAGGG + Intergenic
1145065246 17:19757509-19757531 AGGGAAAGGGAGACCCAGGGTGG - Intergenic
1145158244 17:20556942-20556964 ACGGAGAGGGAGACGGCAGACGG - Intergenic
1145733429 17:27211250-27211272 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733435 17:27211269-27211291 AGGGTGAGGGAGACGGGAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1145733452 17:27211326-27211348 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733460 17:27211351-27211373 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733466 17:27211370-27211392 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733472 17:27211389-27211411 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733478 17:27211408-27211430 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145826133 17:27878561-27878583 AGGGAGGGGGAGAAGGTGGGTGG - Exonic
1146127117 17:30238457-30238479 AGGGAGTGGGAGGCCGAGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146242165 17:31240201-31240223 GGGGAAGGGGAGACCGGGGATGG - Intronic
1146297148 17:31659152-31659174 AGGGAGAGGGAGAGGGAGAAAGG + Intergenic
1146297152 17:31659158-31659180 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297158 17:31659178-31659200 AGGGAGAGGGAGAGGGAGAAAGG + Intergenic
1146297162 17:31659184-31659206 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297170 17:31659204-31659226 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297220 17:31659342-31659364 AGGGAGAGGGAGAGGGAGAAAGG + Intergenic
1146422215 17:32698289-32698311 AGGGGGAGGGAGAGGGGGGAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146943590 17:36859910-36859932 GGGGAGAGGGAGGCCAGGGAAGG + Intergenic
1147133188 17:38420590-38420612 GGGGAGGTGGAGTCCGTGGAAGG + Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147891462 17:43720531-43720553 AGGGACACGGAGATCGAGGAGGG + Intergenic
1148330694 17:46812258-46812280 AGGGACAGGGAGGGCCTGGATGG + Intronic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148602077 17:48901778-48901800 AGAGAGAGGGAGACGGGGGCGGG - Intergenic
1148806399 17:50266208-50266230 AGAGAAAGGGAGAAAGTGGAAGG - Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150001394 17:61443078-61443100 GGGGAGGGGGAGACAGAGGAGGG + Intergenic
1150477845 17:65488076-65488098 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478006 17:65488668-65488690 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150776663 17:68086888-68086910 AAGGAGAGGGAGAAGGTTGAGGG - Intergenic
1151201050 17:72468197-72468219 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1151377683 17:73702326-73702348 AGAGAGAGAGAGACAGGGGAAGG + Intergenic
1151852243 17:76697884-76697906 CGGGAGAGGGAGAGAGGGGAGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152382890 17:79951380-79951402 AGGGAGATGGGGCCCGTGGGGGG + Intronic
1152571231 17:81122099-81122121 AGGGCGAGGGAGAGCGTGAGGGG + Exonic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153987827 18:10368763-10368785 AGGGAGAGGAAGAGCGGGAAAGG + Intergenic
1154302144 18:13203575-13203597 AGAGAGAGAGAGAACGTGGTGGG + Intergenic
1154315765 18:13301980-13302002 TGGGAGGGGGAGAGAGTGGAGGG - Intronic
1156452817 18:37276072-37276094 AGGAAGAGCCAGACCGAGGAGGG - Intronic
1156476617 18:37409631-37409653 AGAGTGAGGGAGACCCTGGCGGG + Intronic
1156537215 18:37875585-37875607 AGGGACAGGGAGAGACTGGAGGG - Intergenic
1156980130 18:43277052-43277074 AGGGAGAGAGATACCAAGGAAGG + Intronic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157368080 18:47084939-47084961 AAGGGGAGGGAGACGGTGGTGGG - Intronic
1157372627 18:47130502-47130524 AGGGAGAGGGAGATGGGGGTTGG + Intronic
1157444327 18:47733449-47733471 AGGGAAATGGAGACCCTGGTTGG - Intergenic
1157682213 18:49615970-49615992 AGGGAGAGGGAGGCCAAGAAAGG + Intergenic
1157793786 18:50557396-50557418 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
1157878058 18:51292033-51292055 AGGAAGGGAGAGACCGAGGACGG - Intergenic
1157905160 18:51563242-51563264 AGGGAGAGGGAGTCCGGAGAGGG + Intergenic
1158653085 18:59305145-59305167 AGAGGGAGGGAGATCATGGAAGG + Intronic
1158723793 18:59949754-59949776 TGGGAGAGGCAGACCCTGGCAGG + Intergenic
1159323196 18:66881682-66881704 GGGGAGAGGGCGACCGAAGAGGG - Intergenic
1159360035 18:67388383-67388405 AGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1160962376 19:1728714-1728736 AGGGAGAGGGAGGCGGAGGTTGG + Intergenic
1161241236 19:3225013-3225035 AGGGAGGGGGAGAGGGGGGAGGG - Intronic
1161266344 19:3366480-3366502 AGGAGGAGGGAGACCGAGGGAGG + Intronic
1161642917 19:5435597-5435619 AGGGAGATGGAAGCCATGGAGGG - Intergenic
1162376788 19:10309742-10309764 AGGGGGAGGGCTAGCGTGGAAGG - Exonic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163162719 19:15475164-15475186 AGGGTGAGGGAGAGAGAGGAGGG + Intronic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1164066240 19:21720271-21720293 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066246 19:21720290-21720312 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066252 19:21720309-21720331 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066258 19:21720328-21720350 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066264 19:21720347-21720369 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066270 19:21720366-21720388 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164508632 19:28879484-28879506 GGAGAGAGGGAGTGCGTGGATGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165137518 19:33679040-33679062 AGGGAGAGAGATTCCCTGGAAGG + Intronic
1165205377 19:34180544-34180566 ACAGAGAGGGAGATCGTGGTGGG - Intronic
1165295595 19:34923009-34923031 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1165295598 19:34923028-34923050 AGGGAGAGGGAGACCTTCTGAGG + Intergenic
1165419963 19:35717831-35717853 CGGGAGAGGGAGTCCGCGGCCGG - Intergenic
1165917423 19:39269293-39269315 AGGGAGAAAGAGACGGTGAAGGG - Intronic
1165939582 19:39408390-39408412 AGGCAGAGGGTGACAGTGGAAGG - Exonic
1166007136 19:39915587-39915609 AGCGAGCTGGAGACCCTGGAAGG + Exonic
1166112385 19:40630590-40630612 AGGGAGCAGGAGTCCCTGGAGGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166213896 19:41323654-41323676 AGGGAGAGGAAGGCGGAGGAAGG - Exonic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166558293 19:43716117-43716139 GGGGAGAGGGAGAGCCTGCAGGG + Exonic
1166708603 19:44922979-44923001 AGGGAGGAGGCGATCGTGGACGG - Intergenic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167414077 19:49361382-49361404 AGGGAGACGGAGACCTAGAAAGG + Exonic
1167608251 19:50493178-50493200 AGGGCGAGAGAGACAGAGGAAGG + Intergenic
1167618381 19:50548504-50548526 GGGCAGAGGGGGACCTTGGAGGG - Intronic
1167715833 19:51142400-51142422 TGGGGGAGGGAGAGGGTGGAAGG + Exonic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168067581 19:53927400-53927422 AGGGTGAGAGAGACCAGGGAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168514629 19:57001271-57001293 AGAGAGAGCGAGACAGGGGAGGG + Intergenic
1202666666 1_KI270708v1_random:126907-126929 AGGGAGATGGAGACAGGAGAAGG + Intergenic
925159474 2:1673932-1673954 AGGAAGGAGGAGACCCTGGAAGG - Intronic
925307518 2:2860971-2860993 AGGAGGAGAGAGACCCTGGAAGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
925833289 2:7917637-7917659 AGGGAGAGAGAGAGGGAGGAAGG + Intergenic
926093165 2:10063605-10063627 AGGGTGAGGGTGACACTGGAGGG + Intronic
926726877 2:16005319-16005341 AGGGAGAGGGAGAGGGAGGGGGG - Intergenic
927096182 2:19749429-19749451 AGGAAGACTGAGACAGTGGACGG - Intergenic
927946506 2:27137990-27138012 AGGGAGAGGATGCACGTGGACGG + Exonic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928028816 2:27761626-27761648 AGGGAGGGAGAGCCTGTGGAGGG - Intergenic
928165442 2:28968403-28968425 AGGGAGAGAGGGAGCGAGGAGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928596767 2:32866668-32866690 AGGGAGAGGGAGAGGGAGAATGG - Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929778231 2:44941799-44941821 AGGGAGAGGGAGAGAGGAGAGGG - Intergenic
930066664 2:47332791-47332813 AGGGAGAGGCAGACCACGCATGG + Intergenic
930209006 2:48615471-48615493 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209012 2:48615490-48615512 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209018 2:48615509-48615531 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209024 2:48615528-48615550 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930321945 2:49865919-49865941 AGGGAGAGGGAAATGGTAGAGGG - Intergenic
930739405 2:54814531-54814553 AGGGTGAGAGAGACAGAGGAAGG - Intronic
931751856 2:65338148-65338170 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751863 2:65338168-65338190 AGGGAGAGGGAGACGGGAGACGG - Intronic
931751868 2:65338187-65338209 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751874 2:65338206-65338228 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751880 2:65338225-65338247 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751884 2:65338238-65338260 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751890 2:65338257-65338279 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751896 2:65338276-65338298 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751902 2:65338295-65338317 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931767432 2:65469416-65469438 AGAGAGAGAGAGAGCGGGGAGGG - Intergenic
931881437 2:66575122-66575144 AGGGAGAGGGAGACCCAGAGAGG - Intergenic
932060620 2:68494455-68494477 AGGGAGAGGGAGTGAGGGGAAGG + Intronic
933903067 2:86862692-86862714 GGGGAGAGGGACCCCTTGGAGGG + Intergenic
934765038 2:96875927-96875949 AGTGACAGGGAGACAGAGGAAGG + Exonic
934903090 2:98176478-98176500 AGGGAGGGGAAGACCGAAGAAGG - Intronic
935321694 2:101895757-101895779 AGGGAGAGGTAGACCAGGTATGG - Intergenic
935569921 2:104648493-104648515 AGAGAGAGAGAGACTTTGGATGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935777479 2:106486578-106486600 GGGGAGAGGGACCCCTTGGAGGG - Intergenic
936060070 2:109289156-109289178 AGAGAGAGAGAGACAGGGGATGG - Intronic
936673184 2:114683539-114683561 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
938163795 2:129009174-129009196 AGGGAGAGGCAGGCCAGGGACGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938720463 2:134063381-134063403 TGGGAGAGGGAGACGGGAGAGGG - Intergenic
938878009 2:135554168-135554190 GGGAAGAGGGAGAATGTGGAAGG - Intronic
939186995 2:138872362-138872384 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
939387414 2:141518656-141518678 AGGGAGAGAGAGGCCGGGCATGG + Intronic
939996860 2:148927889-148927911 AGGGACAGGGAGAGAGAGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941438474 2:165502726-165502748 AGAGAGAGGGAGCCGGTGGCAGG - Intronic
942177409 2:173347269-173347291 AGTGACAGGGAAACTGTGGATGG + Intergenic
942179318 2:173364957-173364979 AGAAAGAGGAAGACCGTGGATGG + Exonic
942548004 2:177084450-177084472 GGGGAAAGGGAGACTGAGGAAGG + Intergenic
942593124 2:177567375-177567397 AGGAAGAGGGGGCCCGGGGATGG - Intergenic
942818388 2:180080467-180080489 GGGGAGAGGGAGAGAGAGGAAGG - Intergenic
943375556 2:187072100-187072122 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
943411558 2:187555900-187555922 AGGGAGAGGGAGACCGTGAGAGG - Intronic
943635412 2:190301475-190301497 AGGGAGAGGGAGTTGGGGGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943773166 2:191741093-191741115 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773172 2:191741112-191741134 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773178 2:191741131-191741153 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773186 2:191741156-191741178 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773193 2:191741176-191741198 AGGGAGAGGGAGACAGGGAGAGG - Intergenic
943773198 2:191741195-191741217 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773204 2:191741214-191741236 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
944599044 2:201284655-201284677 AGGGAGAGGGAGACGGGGAGAGG + Intronic
944599053 2:201284681-201284703 AGGGAGAGGGAGACGGGGAGAGG + Intronic
945043015 2:205758170-205758192 AGAGATAGGCAGACCTTGGAAGG + Intronic
945090544 2:206172597-206172619 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090550 2:206172616-206172638 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090556 2:206172635-206172657 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090562 2:206172654-206172676 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090568 2:206172673-206172695 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090574 2:206172692-206172714 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090580 2:206172711-206172733 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090592 2:206172748-206172770 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090604 2:206172785-206172807 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090612 2:206172810-206172832 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090618 2:206172829-206172851 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090626 2:206172854-206172876 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090634 2:206172879-206172901 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090642 2:206172904-206172926 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090650 2:206172929-206172951 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090658 2:206172954-206172976 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090664 2:206172973-206172995 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090670 2:206172992-206173014 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090674 2:206173005-206173027 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090680 2:206173024-206173046 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090684 2:206173037-206173059 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090690 2:206173056-206173078 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090696 2:206173075-206173097 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090702 2:206173094-206173116 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090708 2:206173113-206173135 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090716 2:206173138-206173160 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945139317 2:206667129-206667151 ATGAAGAGGGAGCCCCTGGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970611 2:216227534-216227556 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970617 2:216227553-216227575 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970623 2:216227572-216227594 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970629 2:216227591-216227613 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970635 2:216227610-216227632 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970639 2:216227623-216227645 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970645 2:216227642-216227664 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970651 2:216227661-216227683 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970657 2:216227680-216227702 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970663 2:216227699-216227721 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970669 2:216227718-216227740 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970675 2:216227737-216227759 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
946165023 2:217858507-217858529 AGGGAGAGGGAGGAAGCGGAGGG + Intronic
946175703 2:217920962-217920984 AGGGAGAGGGGGAGAGTAGAGGG + Intronic
946227273 2:218270605-218270627 AAGGAGAGGGACCCCGGGGAGGG + Intronic
946292967 2:218759564-218759586 AGGGAGGGGTAGACTGTAGAGGG + Intergenic
946352550 2:219164884-219164906 AGGGAGAGGCAGACAGTTGAAGG - Intronic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
946804837 2:223461838-223461860 AGGAAGAGAGAGATGGTGGAAGG - Intergenic
947528771 2:230895485-230895507 AGGGAGAGGGTGACCCTTGGTGG - Intergenic
947624031 2:231608294-231608316 GGGCAGAGGGAGAACTTGGAAGG - Intergenic
947941921 2:234064238-234064260 AGAGAGAGAGAGACAGAGGAAGG - Intronic
947955367 2:234185312-234185334 AGGGAGAGGTTGGCAGTGGAAGG + Intergenic
948233210 2:236366774-236366796 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
948356671 2:237383781-237383803 AGGGGGAGGGAAAACGTGGGAGG - Intronic
948434986 2:237946995-237947017 AGAGAGAGAGAGAGAGTGGAAGG - Intergenic
948558571 2:238835275-238835297 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
948678294 2:239611945-239611967 AGTGAAAGGGAGTCCCTGGAGGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169085316 20:2822522-2822544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085322 20:2822541-2822563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085330 20:2822566-2822588 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085334 20:2822579-2822601 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085338 20:2822592-2822614 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085344 20:2822611-2822633 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085350 20:2822630-2822652 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085356 20:2822649-2822671 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085362 20:2822668-2822690 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085368 20:2822687-2822709 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085374 20:2822706-2822728 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085380 20:2822725-2822747 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085386 20:2822744-2822766 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085392 20:2822763-2822785 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085398 20:2822782-2822804 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085404 20:2822801-2822823 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085410 20:2822820-2822842 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085416 20:2822839-2822861 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085422 20:2822858-2822880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085428 20:2822877-2822899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085434 20:2822896-2822918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085440 20:2822915-2822937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085446 20:2822934-2822956 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085452 20:2822953-2822975 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085458 20:2822972-2822994 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085464 20:2822991-2823013 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169564709 20:6841348-6841370 AGGGAGAGAGAGAGAGAGGAGGG + Intergenic
1169945014 20:10978965-10978987 GGGGAGAGGGAGACGGGGCAGGG - Intergenic
1169951752 20:11052345-11052367 AGGGAGAAGGAGACAGTGAGAGG - Intergenic
1170703834 20:18727493-18727515 AAGGAGAGGGCGGCCCTGGAAGG + Intronic
1170981059 20:21213295-21213317 AGGGAGAGTCAGAGCATGGAAGG - Intronic
1171284068 20:23923463-23923485 AGGAAGAGGAAGCCCCTGGAGGG + Intergenic
1172024383 20:31938083-31938105 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1172024393 20:31938109-31938131 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1172126028 20:32625913-32625935 AGGGACAGGGAGACTGAGGGTGG - Intergenic
1172250310 20:33474834-33474856 AGGGATAGGCAGACCGTGTGCGG + Intergenic
1172393406 20:34581920-34581942 AGGCAGAGGGGGACTGTTGATGG - Intronic
1172442653 20:34977053-34977075 AGGGAGAGAGAGAGGGGGGAGGG - Intronic
1172720788 20:36999452-36999474 AGGGAGAGGGAGAGGAGGGAGGG - Intronic
1172740726 20:37164382-37164404 AGGGAGAGGGAGACAGAGAGAGG - Intronic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1173067814 20:39729756-39729778 AGAGAGAGAGAGACAGGGGAGGG - Intergenic
1173670996 20:44798821-44798843 AGGGAGAGGGAGACGCAGCATGG - Intronic
1173873893 20:46357821-46357843 AGGAAGAGGGAGCCGGTGGGGGG - Intronic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1173987662 20:47275006-47275028 AGAGAGAGAGAGACCAAGGAAGG + Intronic
1174424128 20:50420073-50420095 AGGGAGCGGGAGCCCTGGGAGGG - Intergenic
1174525366 20:51166171-51166193 AGTGAGAGGGAGGCTCTGGATGG + Intergenic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175310249 20:58006787-58006809 CGGGACAGGGACACCGGGGAGGG + Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175339685 20:58220508-58220530 AGAGAGAGAGAGAGAGTGGAAGG + Intronic
1175503316 20:59465476-59465498 AGGAGGAGGGAGACAGAGGAAGG - Intergenic
1175626853 20:60495761-60495783 AGGAACAGGCAGACAGTGGATGG - Intergenic
1175871971 20:62213215-62213237 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872006 20:62213300-62213322 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872062 20:62213435-62213457 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872133 20:62213607-62213629 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872170 20:62213694-62213716 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1176209695 20:63913066-63913088 AGGGAGATGGAGACGGGGCAGGG - Intronic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177529331 21:22339996-22340018 AGGAAGAGAGAGACAGTGGGAGG + Intergenic
1177535671 21:22423788-22423810 AGGGAGAGAAAGAACATGGAAGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179195007 21:39156532-39156554 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195015 21:39156557-39156579 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195023 21:39156582-39156604 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195029 21:39156601-39156623 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195037 21:39156626-39156648 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179538473 21:42067987-42068009 AGGGAGAGAGAGATGGGGGAGGG + Intronic
1179604793 21:42507728-42507750 AGGAAGAGAGAGAGCATGGAGGG + Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1181079575 22:20405166-20405188 AGGGAGAGGAAGAACACGGAAGG - Intronic
1181426803 22:22849055-22849077 AGGGAGAGGGAGGGGGTGGTAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181977188 22:26738401-26738423 AGGGAGAGGGAGAAGGGGAAGGG - Intergenic
1182053669 22:27332443-27332465 GGAGAGAGAGAGACCGGGGATGG - Intergenic
1182399659 22:30066072-30066094 AGGGAGAGGGAGACAGAGGGAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183378418 22:37478587-37478609 AGGGAGAGGGTGCCCCAGGAGGG + Intronic
1183871894 22:40746373-40746395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871900 22:40746392-40746414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871906 22:40746411-40746433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871912 22:40746430-40746452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871920 22:40746455-40746477 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871926 22:40746474-40746496 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871932 22:40746493-40746515 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871938 22:40746512-40746534 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871944 22:40746531-40746553 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871950 22:40746550-40746572 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871956 22:40746569-40746591 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871960 22:40746582-40746604 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871966 22:40746601-40746623 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1184196108 22:42929774-42929796 AGGGAGAAGGATACTGTGAAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184345761 22:43911717-43911739 AGGGATGGGGAGACCAGGGAGGG - Intergenic
1184808954 22:46815854-46815876 AGGGAGAGGGCCTGCGTGGAGGG + Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1185015287 22:48339272-48339294 AGGGACAGGGAGAGTGCGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185404704 22:50641312-50641334 ATGGAGAGGGATACCCTGGCAGG - Intergenic
949582905 3:5408826-5408848 AGGTGGAGGAAGACCGTAGATGG + Intergenic
949614646 3:5739687-5739709 AGGGGAAGGGAGACAGGGGAGGG - Intergenic
950019498 3:9777123-9777145 AGGGTGAGTGAGAACGGGGAGGG - Intronic
950520467 3:13494963-13494985 AGGGAGAGGGTGGCCAGGGATGG - Intronic
950835361 3:15914155-15914177 AGTGAGAGTGAGAGCGTGAAGGG + Intergenic
953194174 3:40716168-40716190 AGGGACAGGTAGACCCTGGAGGG - Intergenic
953368292 3:42366057-42366079 AGGGAGTGGGGGATTGTGGAAGG + Intergenic
954079863 3:48207301-48207323 AGGGAGATGGATACCCAGGAGGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954436696 3:50500065-50500087 AGGGAGATGGAGACAGGGGCTGG + Intronic
954461848 3:50631321-50631343 AGGGAGAGGGAGGACATGGGGGG + Intronic
954629485 3:52040293-52040315 AGGGAGGGGGACACAGTGGTGGG - Intergenic
954883087 3:53848958-53848980 AGGGAGATCAAGGCCGTGGAAGG + Intronic
955064891 3:55525751-55525773 AGGCAGTGGGACACCATGGAAGG + Intronic
955155730 3:56414767-56414789 AGGGAGAGAGAGAGAGTGGAAGG - Intronic
955233937 3:57123315-57123337 AGGGACAGGGAGCCAGTGAAGGG - Intronic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955520776 3:59773367-59773389 GGGGAGAGGGAGACACTAGAGGG + Intronic
955539567 3:59960113-59960135 AGAGAGAGGAAGACAGTGGGTGG + Intronic
955671370 3:61406575-61406597 AGAGAGAGGGATACCATGCAAGG - Intergenic
956004440 3:64763457-64763479 AGGGAGAAAGAGACAGTGTAGGG + Intergenic
956199253 3:66689470-66689492 AGGGCGAGGGAGCCCGCTGATGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956321918 3:68007415-68007437 ATGAAGAGCGAGGCCGTGGAAGG - Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
957188970 3:76981840-76981862 AGAGAGAGCGAGAGAGTGGATGG + Intronic
959276144 3:104279378-104279400 AGAGAGAGAGAGACTGTTGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960073466 3:113458163-113458185 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073470 3:113458176-113458198 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073474 3:113458189-113458211 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073478 3:113458202-113458224 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960720680 3:120622298-120622320 AGGGAGAGAGAGAAAGTGGGGGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961413650 3:126741923-126741945 AGGGAGAGGGAGACAAAGCAGGG - Intronic
961514524 3:127424426-127424448 AGGGAGAGGGAATCAGTGGCCGG - Intergenic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962318771 3:134374588-134374610 AGGGAGCGGGAGAAGGCGGAGGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962685597 3:137844955-137844977 AGGGAGAGGGAGAGGATGGATGG - Intergenic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963438687 3:145308032-145308054 AGGCAGAGAGAGACAGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963911868 3:150822062-150822084 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
964494359 3:157272297-157272319 AGGGAGAGAGAGAGAGAGGAAGG - Intronic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965881725 3:173395874-173395896 GGGGAGAGGGAGGCAGCGGAGGG + Intergenic
966155990 3:176917083-176917105 AGGGTGAGAAAGTCCGTGGATGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967489814 3:190077404-190077426 AGGGAGGTGGAGACCTAGGAAGG - Intronic
968118570 3:196108401-196108423 AGGGGAAGGGAGATAGTGGAGGG + Intergenic
968122540 3:196135827-196135849 ATGGACAGTGAGACCGTGGAGGG + Intergenic
968347961 3:198027180-198027202 TGGGAGTGGGAGAAAGTGGACGG - Intronic
968481144 4:833569-833591 AGGAAGAGGGGGAAGGTGGAAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968534754 4:1116981-1117003 AGGGAGCTGGAGAGCTTGGAAGG - Intergenic
968653007 4:1767424-1767446 AGGGAGAGGGAGGGGGAGGAGGG - Intergenic
969414237 4:7048284-7048306 AGGGGGAGGGAGAGCCCGGATGG + Intronic
969544927 4:7819697-7819719 CGGGAGAGGGAGAACGTGGTAGG + Intronic
969833500 4:9818517-9818539 AGGGTGAGGGAGTCAGTGGATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971864211 4:32147734-32147756 AGAGAGAGAGAGACAGAGGAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973263191 4:48185822-48185844 AGGGAGAGGGAGATGGGAGAGGG - Intronic
973263199 4:48185847-48185869 AGGGAGAGGGAGACGGGAGAGGG - Intronic
973607209 4:52599818-52599840 AGGGAAAGGGAGACAGTAGCTGG - Intronic
973835330 4:54803698-54803720 AGGGACAGGGAGGCCATGAAGGG - Intergenic
973993766 4:56436349-56436371 GGGGTCAGGGAGACCGTGAAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976126024 4:81834521-81834543 AGGGAGTGGGGGAGGGTGGAGGG + Intronic
977809729 4:101346137-101346159 AGAGAGCGGGAGAGCGTGGGGGG - Intronic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
978405125 4:108371101-108371123 AGGGAGAGGGAGGCCAAGGGAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979053542 4:115968086-115968108 AGGGAGAGAGAGAGGGTGAAGGG - Intergenic
979242281 4:118458172-118458194 AGGGACAGGGAGAAAATGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
980791200 4:137621401-137621423 AGGGAAAGGGACACTGAGGAAGG - Intergenic
980795759 4:137680482-137680504 AGGGAGGGGGAGAAAGTGAAGGG + Intergenic
981456898 4:144962850-144962872 AGGAATAGGGAGACCTTGGAGGG - Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981818374 4:148857338-148857360 AGTCTGAGGGAGTCCGTGGAGGG - Intergenic
981872602 4:149504903-149504925 AGAGAGAGAGAGACCCTGGGAGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982050612 4:151498045-151498067 AGAGAGAGGGGGTCAGTGGATGG - Intronic
982184240 4:152779908-152779930 AGGGAGAGAGAGGCCGTCCAGGG + Intronic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984295844 4:177853571-177853593 AGTGAGAGGGAAACGGTAGATGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
984924356 4:184793659-184793681 AGGGAGAGTGAGAGAGAGGAGGG + Intronic
985677057 5:1237603-1237625 TGGGAGAGGGAGGCCAGGGAGGG + Intronic
986309862 5:6543944-6543966 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
987024265 5:13908361-13908383 AAGGAGAGGGAGGCAGTGGAAGG - Intronic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987448910 5:18056835-18056857 AGAGAGAGGGAGACAGAGAAGGG + Intergenic
987543869 5:19288030-19288052 AGGGCACGGGAGCCCGTGGAGGG - Intergenic
987920378 5:24272665-24272687 AGGGAGGGGGACAAGGTGGATGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990297917 5:54421357-54421379 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
991073996 5:62514590-62514612 AGGGAGAGGGAGACGGGAGAGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992565076 5:77988178-77988200 TGGGAGAGGGATGCCGTGGGAGG + Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993042612 5:82832362-82832384 AGAGTGAGGGAGTCTGTGGATGG - Intergenic
993111132 5:83658773-83658795 AGGGAGAGGGTTAGCATGGATGG - Intronic
993332159 5:86614630-86614652 AGGGAGAGGGAGACAGGGAAAGG - Intergenic
993653624 5:90552128-90552150 AGAGAGAGAGAGACTGTGTATGG + Intronic
993888074 5:93440137-93440159 AGGGAGAGAGAGAATGTGGGTGG - Intergenic
993900597 5:93581754-93581776 AGGGAGAGGGAGAGAGGAGAGGG - Intergenic
993906736 5:93631798-93631820 AGGGAGAGGGGGAGAGGGGAGGG + Intronic
995245342 5:109928976-109928998 AGGGACAGGGAGCCCCTGAAAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996436171 5:123434940-123434962 AGGGAGAGGGAGAGAGGGAAGGG + Intergenic
997083748 5:130771747-130771769 AGGTAGTGGGAGACTGTGGGGGG + Intergenic
997321806 5:132983928-132983950 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
997578843 5:135004766-135004788 AGGGAGAGGGGGAAGCTGGAAGG + Intronic
998387500 5:141766222-141766244 AGGGACAGGAAGGCAGTGGAGGG - Intergenic
998405117 5:141869849-141869871 AGGGAGAGAGAGCCAGTGGAAGG + Intronic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
999692585 5:154161413-154161435 AAGGAGACAGAGACCATGGATGG + Intronic
1000379661 5:160617337-160617359 AGGGAGAGGTAGAGAGTGGTAGG + Intronic
1000635741 5:163641716-163641738 AGGGAGAGGGAGACAGAGAGGGG + Intergenic
1000953738 5:167517423-167517445 AGGGATAGGGAGATAATGGATGG + Intronic
1001266847 5:170279961-170279983 AGGGAGAGAGAGAGGGGGGAAGG + Intronic
1001383824 5:171321641-171321663 AGGGAGAGGGAGGCCGGGGGAGG - Intergenic
1001436840 5:171705752-171705774 AGGAAGAGGGAGACGGTGGTGGG - Intergenic
1001547990 5:172582379-172582401 TGGGAGAGGGAGCCTGGGGAAGG + Intergenic
1001603614 5:172944847-172944869 CTGGAGGGGGAGACCCTGGATGG - Intronic
1002031353 5:176433028-176433050 AGGGAGAGGGAGAGGAGGGAGGG - Intergenic
1002187145 5:177459648-177459670 AGGGAAAGGGAGTCCGTGGAGGG + Intronic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1002644831 5:180648002-180648024 AGGAAGAGAGAGACCCGGGAGGG - Intronic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1002886078 6:1295499-1295521 AGGGAGAGGAAGGCAGGGGAGGG - Intergenic
1002970887 6:2018033-2018055 AGGGTGAGGAAGACTATGGATGG - Intronic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003998172 6:11564913-11564935 AGGGAGAAGGAGTCAGTGCAAGG + Intronic
1005063777 6:21798391-21798413 AGGGAGAGGGAGAGGGAGGGGGG + Intergenic
1005836965 6:29717712-29717734 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836971 6:29717731-29717753 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836977 6:29717750-29717772 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836983 6:29717769-29717791 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836989 6:29717788-29717810 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836995 6:29717807-29717829 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837001 6:29717826-29717848 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837012 6:29717858-29717880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837018 6:29717877-29717899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837024 6:29717896-29717918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837030 6:29717915-29717937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1006336028 6:33420846-33420868 AGAGAGAGGGAGGCAGTGGGGGG + Intronic
1006501547 6:34462573-34462595 AGGGAGAGGGAGGAGGTGGGTGG - Intergenic
1006639098 6:35479872-35479894 AGGGAGAGGGAGACCATCTGGGG - Intronic
1006671475 6:35732072-35732094 AGGGAGAGCAAGACCGGGGGAGG + Intergenic
1006787637 6:36679101-36679123 GGGGCGAGGGAGGGCGTGGACGG + Intronic
1006840627 6:37026054-37026076 AGGAAGAGGGAGAGGGGGGAGGG - Intronic
1006888009 6:37398387-37398409 GGGGTGAGGGAGAGCCTGGAGGG + Intergenic
1006945921 6:37784458-37784480 AGGGAGAGGGAGGCGGTGGGGGG + Intergenic
1007065457 6:38986444-38986466 AGGGAAAAGGAGACAGTGAATGG + Intronic
1007116399 6:39346102-39346124 AGGGAGAGGGAGAGGGAGGGGGG - Intronic
1007321996 6:41034187-41034209 AGGGAGAGGGAGAGCTGAGATGG + Intronic
1007352482 6:41283969-41283991 AGGAAGAGGGGGATAGTGGAGGG + Intronic
1007522841 6:42465689-42465711 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1007768523 6:44176034-44176056 AGAGGGAGGGAGAGCATGGAGGG - Intronic
1008179793 6:48314440-48314462 AGGGAGTGGGAGACCCAGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008926787 6:56895995-56896017 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926793 6:56896014-56896036 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926799 6:56896033-56896055 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926805 6:56896052-56896074 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926811 6:56896071-56896093 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926817 6:56896090-56896112 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926823 6:56896109-56896131 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1010376479 6:75176350-75176372 AGGGAGAGGGATGCTGTGGGAGG + Intronic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011426995 6:87240349-87240371 AGGGAGAGGGAGACCCGTGGCGG + Intronic
1012111614 6:95242122-95242144 AGGGAGAGGGAGGGAGGGGAAGG + Intergenic
1013608571 6:111773486-111773508 AGGGAGAGGGAGAGCGGGGGAGG + Intronic
1014764410 6:125390105-125390127 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764416 6:125390124-125390146 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764422 6:125390143-125390165 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764428 6:125390162-125390184 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764434 6:125390181-125390203 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1015189902 6:130461106-130461128 AGGGAAAGGGAGGCAGTGGGAGG - Intergenic
1016008083 6:139109596-139109618 TGGGAGAGGGAACCGGTGGAAGG + Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016480039 6:144471020-144471042 GGGGAGAGGGAGACGAGGGAGGG + Intronic
1017128732 6:151090286-151090308 AGGGAAAGGGAGACTGGGGGTGG - Intronic
1017131728 6:151113629-151113651 AGGGTGAGGGAGGTGGTGGATGG + Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017998656 6:159558142-159558164 AGGGAAAGGAAGACCCTGCAAGG + Intergenic
1018072567 6:160178324-160178346 AGGGAGAGGGAGAGGGAGGGAGG + Intronic
1018298645 6:162376821-162376843 AGGGAGAGGGAGAGGGAGGGAGG + Intronic
1018429787 6:163713717-163713739 AGGGTGAGGGGCAGCGTGGAGGG - Intergenic
1019057826 6:169235878-169235900 TGGGGGAGGGAGAATGTGGATGG - Intronic
1019057856 6:169236006-169236028 TGGGGGAGGGAGAGTGTGGATGG - Intronic
1019160781 6:170066067-170066089 AGGGATAGGGATAGGGTGGATGG - Intergenic
1019404818 7:877699-877721 AGGGAGGGGGAGGCCGGGCAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019990710 7:4688760-4688782 AGGGGGAGGGACACAGTGAATGG - Intronic
1020024341 7:4888377-4888399 AGGGAGGGGGTGAGAGTGGATGG - Intergenic
1020439863 7:8205988-8206010 AGGGGGAGAGAGGCTGTGGAGGG - Intronic
1020916384 7:14198841-14198863 AGGGATAGGGGGAACCTGGAAGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022509698 7:30927240-30927262 GGGGAGAGTCAGGCCGTGGAAGG - Intergenic
1022659098 7:32349391-32349413 AGGGACTGGGAGAGTGTGGAGGG + Intergenic
1023044005 7:36196384-36196406 AGGGAGAGGGAGATGGGAGAGGG - Intronic
1023044013 7:36196409-36196431 AGGGAGAGGGAGATGGGAGAGGG - Intronic
1023059498 7:36314486-36314508 AGGCTGAGGGAGACCTGGGATGG + Intergenic
1023803258 7:43853007-43853029 AGAGAGAGGGAGAGAATGGATGG - Intergenic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1023936536 7:44744015-44744037 AGGGAAAGGGTGACCCTGAAGGG - Intergenic
1024304971 7:47921906-47921928 AGGGAGAGGGAGAGGGGGAAAGG - Intronic
1024383333 7:48724067-48724089 AGGGAGAGGGAGAAGGTGCTGGG + Intergenic
1025626898 7:63230817-63230839 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025626910 7:63230863-63230885 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026361126 7:69601002-69601024 AGGGAGGGGGAGACTGTCCAGGG + Intronic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1027046585 7:74995107-74995129 ACGGAGCGGGATACCCTGGAGGG + Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1028033808 7:85953144-85953166 GGAGAGAGTGAGACAGTGGAAGG - Intergenic
1028539500 7:91926511-91926533 AGGGAAAGGGAGGCAATGGAAGG + Intergenic
1028595849 7:92545844-92545866 AGGGAGAGGGAGACGGGAGACGG + Intergenic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029141674 7:98415180-98415202 AGGGAGGGGGAGAGAGAGGAGGG + Intergenic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029745280 7:102512843-102512865 AGGGAGGGGGAGACTGAGGGAGG + Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1030994398 7:116340764-116340786 AGGGAGAGGAAGACCGGTGCTGG + Intronic
1031021903 7:116638147-116638169 AGAGAGAGGGAGACGGAGGGAGG - Intergenic
1031769418 7:125824357-125824379 AGAGAGCAGGAGACGGTGGAGGG + Intergenic
1031898963 7:127389151-127389173 AGGGAGAGAGAGTAAGTGGAAGG + Intronic
1032043087 7:128577727-128577749 AGGGAGAGGGAGAGGGAGAAGGG + Intergenic
1032461885 7:132117954-132117976 GGGGAGTGGGAGCCAGTGGATGG + Intergenic
1032841782 7:135719925-135719947 AGGGGGAGAGAGACAGGGGAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033473494 7:141669070-141669092 TGGGAGAGGGATACAGGGGAGGG - Intronic
1033596883 7:142865128-142865150 AGGTAGAGGAAGGCAGTGGATGG + Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034272431 7:149809648-149809670 AGAGACAGGGAGACCCTGCAAGG + Intergenic
1034298573 7:149995396-149995418 AGGGAGAGGAGGACAGGGGAAGG + Intergenic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034807441 7:154101382-154101404 AGGGAGAGGAGGACAGGGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035092390 7:156324724-156324746 AAGGAGAGGGAGAGAGTGGGAGG + Intergenic
1035232282 7:157472521-157472543 GGGGAGAGGGAGCCCGTGCCTGG + Intergenic
1035309164 7:157953791-157953813 AGGGTGAGGGCGACCGAGAAAGG + Intronic
1035404772 7:158589708-158589730 AGGGAGAGGGAGAGAGTTGAGGG - Intergenic
1036157607 8:6357134-6357156 AGGGACAGGGAACCCATGGATGG - Intergenic
1036213853 8:6863425-6863447 AGGGAGTGGGAGAGGCTGGAGGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036497628 8:9283839-9283861 AGGGAGAGGAAGAAGCTGGAAGG - Intergenic
1036678180 8:10851968-10851990 AGGGAAAGGGAGCGCGGGGAAGG + Intergenic
1037022436 8:13989904-13989926 AGGGAGAGGGAGACTCTGTATGG + Intergenic
1037888582 8:22608695-22608717 AGGGAGAGTGAGACTGAGGAAGG - Intronic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038412383 8:27368427-27368449 AAGGTGAGGGAGTCAGTGGAGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039753332 8:40497224-40497246 AGGGAGAGGGAGGCAGTGGAGGG + Intergenic
1040016740 8:42706305-42706327 GGGGTCAGGGAGACTGTGGAGGG + Intronic
1040053035 8:43034001-43034023 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1040067755 8:43161968-43161990 AGGGACAGGGAGTCCGTGCGAGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041313542 8:56539693-56539715 AGAGAGGGAGAGACAGTGGAGGG + Intergenic
1041357863 8:57021193-57021215 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357869 8:57021212-57021234 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357877 8:57021237-57021259 AAGGAGAGGGAGACGGGAGAGGG - Intergenic
1042327971 8:67548128-67548150 AGGGAGAGAGAGAGAGAGGAAGG - Intronic
1042513923 8:69640094-69640116 AGGGAGAGAGAGAGAGAGGAAGG + Intronic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1044248932 8:89984258-89984280 AGGGAGGGGGAGTCAGGGGAGGG + Intronic
1044582412 8:93835281-93835303 AGGGAGAGGGAGAGGGAGGTCGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045350250 8:101331655-101331677 TGAGAGAGTGAGACCCTGGAAGG + Intergenic
1046464060 8:114579786-114579808 AGGGTGTGGGAGATTGTGGAAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046744643 8:117863779-117863801 AGGGTGAGGAAGAAGGTGGAAGG + Intronic
1047388776 8:124432851-124432873 AGGGAGAGGGAGACGGGGAGAGG + Intergenic
1048499261 8:134960866-134960888 AGGGAGGGTGAGATGGTGGATGG + Intergenic
1048572565 8:135667716-135667738 AGGGAGAGGGAGAGCTATGAAGG + Intergenic
1048761950 8:137804956-137804978 AGGGAGAGAGGGACCGAGGGAGG + Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049519505 8:143080774-143080796 AGGGAGAGGGAATGCGGGGAAGG + Intronic
1050231653 9:3532276-3532298 AGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051602314 9:18887837-18887859 AGGGACAGGGTGACCTTTGATGG - Exonic
1051854235 9:21544466-21544488 AGGGAGTGGGAGGCAGTGGGGGG - Intergenic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1053024407 9:34718317-34718339 AGGGAGAGGGGGGCCTGGGAAGG - Intergenic
1053041537 9:34877866-34877888 AGGGAGGGGGAGATAGGGGAGGG - Intergenic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053330895 9:37206293-37206315 AGGGAGAGGGAGAGGGGGAAGGG - Intronic
1054759692 9:68993225-68993247 AGGAAGAGGGAGACCCAGGGAGG - Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055580745 9:77703883-77703905 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1056545124 9:87606706-87606728 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
1057866637 9:98686884-98686906 GGGGAGAGGCAGAGCTTGGAGGG - Intronic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1058560707 9:106226093-106226115 AGGAAGGGGGAGATGGTGGAGGG - Intergenic
1059092758 9:111378273-111378295 AGGGCGAGGGAGCCCATGGAAGG + Intronic
1059234605 9:112751029-112751051 AGGGAGTGGGGCCCCGTGGACGG - Exonic
1059321230 9:113471648-113471670 ACGGAGAGAGAGAGCGGGGAGGG - Intronic
1059616538 9:115957822-115957844 AGAGAGAGTGAGACTGTGGGAGG - Intergenic
1060041331 9:120304263-120304285 AGGGAGAGGGAGAGGGAGGGGGG - Intergenic
1060750686 9:126166439-126166461 GGGGAGAGGGACACTGGGGAGGG + Intergenic
1060989155 9:127838420-127838442 AGGCAGTGGGAGGCCATGGAAGG - Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061180566 9:129022873-129022895 AGGGAGAGGGTGCCAGAGGAGGG + Intronic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061634824 9:131900922-131900944 AGGGAGAGGGAGAGAGAGGGAGG + Intronic
1061756964 9:132821264-132821286 AGGGACAGAGTGAGCGTGGAGGG - Intronic
1061849437 9:133405779-133405801 AGGGAGAGGGCACACGTGGAGGG - Exonic
1061900039 9:133668316-133668338 AGGGAGAGGGAGAGGGAGGGTGG - Intronic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061922387 9:133789201-133789223 AGGGAGAGCCAGACCCTGGCGGG + Intronic
1062033426 9:134372219-134372241 AGGGAGAGGGAGAGCCAGGTAGG + Intronic
1062050572 9:134444570-134444592 AGGGAGGGGGAAAGGGTGGAGGG - Intergenic
1062163967 9:135096383-135096405 AGGGAAAGGGAGAGCATGAAGGG - Intronic
1062275200 9:135727192-135727214 AGGGAGAGGGAGAGAGAGAATGG - Intronic
1062571331 9:137186845-137186867 GGGGTCAGGGAGACCGTGAAGGG - Intronic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1185451112 X:281031-281053 AGGGGGAGGGGGGCCGTGCAGGG + Intronic
1185456574 X:313778-313800 AGGCAGAAGGAGCCCCTGGAGGG + Intronic
1185541532 X:906481-906503 ACAGAGAGAGAGACCCTGGAAGG + Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1185630855 X:1514867-1514889 GGGGAGAGGAAGACAGGGGAAGG - Intronic
1185874592 X:3692098-3692120 AGGGAGAGCGAGAGTGGGGAGGG + Intronic
1187850086 X:23583117-23583139 AGGAAGAGGGAGATTTTGGAGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188643359 X:32534425-32534447 AAGGAGAGTGAGACAGTGCAGGG - Intronic
1189211223 X:39285477-39285499 TGGGAGAGGGAGCCTGAGGAAGG - Intergenic
1189306506 X:39990743-39990765 AGGCAGATGGAGACAGTGGTAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189846237 X:45141454-45141476 AGGGAGAGCGAGATGGAGGAGGG + Intergenic
1190061031 X:47211810-47211832 AGGAAGATGGGGACCATGGAAGG - Intronic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1190330786 X:49234053-49234075 AGGGAGGAGGAGACCTTGGTGGG + Intergenic
1190726195 X:53192508-53192530 AGGGAGAGGGAGAAGGGGGTAGG + Exonic
1190764346 X:53463734-53463756 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1192106769 X:68325610-68325632 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1192353161 X:70373295-70373317 AAGGAGGGGGAGAACGGGGAGGG + Intronic
1192366712 X:70479824-70479846 AGGAAGAGGGAGGGGGTGGAGGG + Intronic
1193096629 X:77556192-77556214 AGGGAGAGGGAGAGGGGGAAAGG + Intronic
1195438326 X:104871652-104871674 AGGGACAGGAAGATCTTGGAAGG + Intronic
1195861689 X:109389942-109389964 AAGGTAAGGGAGACCTTGGATGG - Intronic
1196304056 X:114080099-114080121 AGAGAGAGGGAGAGAGTGAAAGG - Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196769797 X:119282101-119282123 ATGGAGAGGGAGGCCGGGCACGG - Intergenic
1197199127 X:123733498-123733520 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197199131 X:123733511-123733533 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197743786 X:129916495-129916517 GCGGAGAGGGAGACAGTGAAGGG - Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1197823578 X:130565574-130565596 AGGGAGGGGTAGATCATGGAGGG + Intergenic
1198321485 X:135521856-135521878 AGGGGGAGGAAGACCGGGGGAGG - Intronic
1198487921 X:137106808-137106830 AGGCAGTGGGAAACCTTGGAGGG + Intergenic
1198858365 X:141043233-141043255 AGAGAGAGGGAGACGGAGAATGG - Intergenic
1198904330 X:141544137-141544159 AGAGAGAGGGAGACGGAGAATGG + Intergenic
1199139100 X:144289112-144289134 AGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199947829 X:152681926-152681948 AGGGAGGGGGAGGCCTTGGTTGG + Intergenic
1199961850 X:152786528-152786550 AGGGAGGGGGAGGCCTTGGTTGG - Intergenic
1199974568 X:152885524-152885546 TGGGAGAGGGAGTCAGAGGAGGG - Intergenic
1200046915 X:153408124-153408146 AGGGAGAGGGAGGCCGTCCTGGG + Intergenic
1200155014 X:153970587-153970609 AGGGAGAGGGAGGAGATGGAGGG + Intronic
1201146127 Y:11066581-11066603 AGGGAGAGGGAGGGAGGGGAAGG + Intergenic
1201146237 Y:11066938-11066960 AGGGAGAGGGAGGGAGAGGAAGG + Intergenic
1201146615 Y:11068128-11068150 AGGGAGAGGGAGTTAGAGGAAGG + Intergenic
1201294944 Y:12454463-12454485 AGGGAGAGGGAGACAGAAGGAGG + Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1202390030 Y:24360286-24360308 AGGGACAGGGAGAAAATGGAAGG - Intergenic
1202480754 Y:25309828-25309850 AGGGACAGGGAGAAAATGGAAGG + Intergenic