ID: 965305838

View in Genome Browser
Species Human (GRCh38)
Location 3:167061980-167062002
Sequence CTATTGATACAAAGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965305833_965305838 18 Left 965305833 3:167061939-167061961 CCACATATAAAGATTGGAATGGA No data
Right 965305838 3:167061980-167062002 CTATTGATACAAAGTGAGGCTGG No data
965305831_965305838 23 Left 965305831 3:167061934-167061956 CCAGTCCACATATAAAGATTGGA No data
Right 965305838 3:167061980-167062002 CTATTGATACAAAGTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965305838 Original CRISPR CTATTGATACAAAGTGAGGC TGG Intergenic
No off target data available for this crispr