ID: 965305838 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:167061980-167062002 |
| Sequence | CTATTGATACAAAGTGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965305833_965305838 | 18 | Left | 965305833 | 3:167061939-167061961 | CCACATATAAAGATTGGAATGGA | No data | ||
| Right | 965305838 | 3:167061980-167062002 | CTATTGATACAAAGTGAGGCTGG | No data | ||||
| 965305831_965305838 | 23 | Left | 965305831 | 3:167061934-167061956 | CCAGTCCACATATAAAGATTGGA | No data | ||
| Right | 965305838 | 3:167061980-167062002 | CTATTGATACAAAGTGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965305838 | Original CRISPR | CTATTGATACAAAGTGAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||