ID: 965307753

View in Genome Browser
Species Human (GRCh38)
Location 3:167088312-167088334
Sequence TTGTTTTAGCATCTAAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965307749_965307753 -7 Left 965307749 3:167088296-167088318 CCCTCTCCTGGGATGTTTGTTTT No data
Right 965307753 3:167088312-167088334 TTGTTTTAGCATCTAAACATGGG No data
965307750_965307753 -8 Left 965307750 3:167088297-167088319 CCTCTCCTGGGATGTTTGTTTTA No data
Right 965307753 3:167088312-167088334 TTGTTTTAGCATCTAAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965307753 Original CRISPR TTGTTTTAGCATCTAAACAT GGG Intergenic
No off target data available for this crispr