ID: 965309348

View in Genome Browser
Species Human (GRCh38)
Location 3:167109933-167109955
Sequence CACACCATGCTCTTACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965309342_965309348 29 Left 965309342 3:167109881-167109903 CCCTAGATGATTGTGCAAAAGAC No data
Right 965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG No data
965309343_965309348 28 Left 965309343 3:167109882-167109904 CCTAGATGATTGTGCAAAAGACA No data
Right 965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965309348 Original CRISPR CACACCATGCTCTTACTAAG AGG Intergenic
No off target data available for this crispr