ID: 965311901

View in Genome Browser
Species Human (GRCh38)
Location 3:167138930-167138952
Sequence CATATAAAAACACCAGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965311901_965311905 24 Left 965311901 3:167138930-167138952 CCAAAGACTGGTGTTTTTATATG No data
Right 965311905 3:167138977-167138999 ACTCATATGCCCAAGGTAGAAGG No data
965311901_965311904 17 Left 965311901 3:167138930-167138952 CCAAAGACTGGTGTTTTTATATG No data
Right 965311904 3:167138970-167138992 TTTAGACACTCATATGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965311901 Original CRISPR CATATAAAAACACCAGTCTT TGG (reversed) Intergenic
No off target data available for this crispr