ID: 965311905

View in Genome Browser
Species Human (GRCh38)
Location 3:167138977-167138999
Sequence ACTCATATGCCCAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965311901_965311905 24 Left 965311901 3:167138930-167138952 CCAAAGACTGGTGTTTTTATATG No data
Right 965311905 3:167138977-167138999 ACTCATATGCCCAAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965311905 Original CRISPR ACTCATATGCCCAAGGTAGA AGG Intergenic
No off target data available for this crispr