ID: 965313743

View in Genome Browser
Species Human (GRCh38)
Location 3:167164423-167164445
Sequence GCCCTCTGCCTAGCCACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965313743_965313745 13 Left 965313743 3:167164423-167164445 CCTGTTGTGGCTAGGCAGAGGGC No data
Right 965313745 3:167164459-167164481 CTGACCTATTGTGGCACTTGAGG No data
965313743_965313744 4 Left 965313743 3:167164423-167164445 CCTGTTGTGGCTAGGCAGAGGGC No data
Right 965313744 3:167164450-167164472 TGAGTAAAACTGACCTATTGTGG No data
965313743_965313746 14 Left 965313743 3:167164423-167164445 CCTGTTGTGGCTAGGCAGAGGGC No data
Right 965313746 3:167164460-167164482 TGACCTATTGTGGCACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965313743 Original CRISPR GCCCTCTGCCTAGCCACAAC AGG (reversed) Intergenic
No off target data available for this crispr