ID: 965315204

View in Genome Browser
Species Human (GRCh38)
Location 3:167182294-167182316
Sequence TGCACTTTCCCCCTAATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965315200_965315204 13 Left 965315200 3:167182258-167182280 CCAATACCATCACAGGCCTTGAT 0: 32
1: 22
2: 9
3: 73
4: 1064
Right 965315204 3:167182294-167182316 TGCACTTTCCCCCTAATAGGTGG No data
965315201_965315204 7 Left 965315201 3:167182264-167182286 CCATCACAGGCCTTGATATAATC 0: 48
1: 31
2: 6
3: 15
4: 165
Right 965315204 3:167182294-167182316 TGCACTTTCCCCCTAATAGGTGG No data
965315199_965315204 16 Left 965315199 3:167182255-167182277 CCTCCAATACCATCACAGGCCTT No data
Right 965315204 3:167182294-167182316 TGCACTTTCCCCCTAATAGGTGG No data
965315202_965315204 -3 Left 965315202 3:167182274-167182296 CCTTGATATAATCAACTAAATGC No data
Right 965315204 3:167182294-167182316 TGCACTTTCCCCCTAATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965315204 Original CRISPR TGCACTTTCCCCCTAATAGG TGG Intergenic
No off target data available for this crispr