ID: 965317730

View in Genome Browser
Species Human (GRCh38)
Location 3:167211922-167211944
Sequence CTGAGCCAACCGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965317726_965317730 -4 Left 965317726 3:167211903-167211925 CCTTTGGGCTTTGGAGAGTCTGA No data
Right 965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG No data
965317723_965317730 5 Left 965317723 3:167211894-167211916 CCATTCCAGCCTTTGGGCTTTGG 0: 18
1: 48
2: 87
3: 189
4: 500
Right 965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG No data
965317725_965317730 0 Left 965317725 3:167211899-167211921 CCAGCCTTTGGGCTTTGGAGAGT No data
Right 965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965317730 Original CRISPR CTGAGCCAACCGGAGGTGGA AGG Intergenic
No off target data available for this crispr