ID: 965318882

View in Genome Browser
Species Human (GRCh38)
Location 3:167226783-167226805
Sequence GGTTAAGTAAAGACACATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965318882_965318885 -1 Left 965318882 3:167226783-167226805 CCATCATGTGTCTTTACTTAACC No data
Right 965318885 3:167226805-167226827 CAAAGAAATATGAATGGAAGTGG No data
965318882_965318883 -7 Left 965318882 3:167226783-167226805 CCATCATGTGTCTTTACTTAACC No data
Right 965318883 3:167226799-167226821 CTTAACCAAAGAAATATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965318882 Original CRISPR GGTTAAGTAAAGACACATGA TGG (reversed) Intergenic
No off target data available for this crispr