ID: 965319685

View in Genome Browser
Species Human (GRCh38)
Location 3:167237508-167237530
Sequence TCAGTTCCATAGTTAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965319682_965319685 26 Left 965319682 3:167237459-167237481 CCACTATTAGTAATATGGCTGAG No data
Right 965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965319685 Original CRISPR TCAGTTCCATAGTTAGAACC AGG Intergenic
No off target data available for this crispr