ID: 965322870

View in Genome Browser
Species Human (GRCh38)
Location 3:167269200-167269222
Sequence TCACCTTTCTAGTCGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 3, 2: 10, 3: 14, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965322862_965322870 24 Left 965322862 3:167269153-167269175 CCAGAAGCCCTTGATACATTTAG 0: 1
1: 1
2: 12
3: 40
4: 136
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322867_965322870 -7 Left 965322867 3:167269184-167269206 CCCAATCATGAGCTTATCACCTT 0: 1
1: 13
2: 12
3: 22
4: 187
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322860_965322870 28 Left 965322860 3:167269149-167269171 CCCACCAGAAGCCCTTGATACAT 0: 1
1: 1
2: 25
3: 48
4: 130
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322864_965322870 17 Left 965322864 3:167269160-167269182 CCCTTGATACATTTAGAAGTGGG 0: 1
1: 2
2: 27
3: 47
4: 134
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322868_965322870 -8 Left 965322868 3:167269185-167269207 CCAATCATGAGCTTATCACCTTT 0: 1
1: 6
2: 2
3: 14
4: 173
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322866_965322870 16 Left 965322866 3:167269161-167269183 CCTTGATACATTTAGAAGTGGGA 0: 1
1: 2
2: 26
3: 50
4: 131
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58
965322861_965322870 27 Left 965322861 3:167269150-167269172 CCACCAGAAGCCCTTGATACATT 0: 1
1: 1
2: 25
3: 50
4: 124
Right 965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG 0: 1
1: 3
2: 10
3: 14
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965322870 Original CRISPR TCACCTTTCTAGTCGATTCA GGG Intronic