ID: 965325548

View in Genome Browser
Species Human (GRCh38)
Location 3:167299439-167299461
Sequence AAATATAAGCTTCAGTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965325548_965325550 20 Left 965325548 3:167299439-167299461 CCACTCTACTGAAGCTTATATTT 0: 1
1: 0
2: 1
3: 28
4: 234
Right 965325550 3:167299482-167299504 TGGAAGAGTTTTGAATGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 261
965325548_965325549 0 Left 965325548 3:167299439-167299461 CCACTCTACTGAAGCTTATATTT 0: 1
1: 0
2: 1
3: 28
4: 234
Right 965325549 3:167299462-167299484 GAATTATGCAATCGCAAATCTGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965325548 Original CRISPR AAATATAAGCTTCAGTAGAG TGG (reversed) Intronic
900459109 1:2791940-2791962 AAATATTAGCGACAGTAGAAGGG - Intronic
903418145 1:23198822-23198844 AAATATAAAATTCAGGATAGTGG + Intergenic
904669118 1:32149146-32149168 AAATAAAAAATTCACTAGAGGGG - Intronic
904847002 1:33427585-33427607 AAATGATAGCTTCAGTAGAGTGG - Intronic
905726414 1:40255690-40255712 GAATGTAAGCTCCAGGAGAGGGG + Intergenic
906286818 1:44592965-44592987 GGATATAAGCTTGAGGAGAGAGG + Intronic
907756565 1:57316410-57316432 AAATAAAATCTTCATTTGAGGGG - Intronic
909497276 1:76292268-76292290 AAATGGTAGCTTCAGTAGAGTGG + Intronic
909497278 1:76292292-76292314 AAATGATAGCTTCAGTAGAGTGG + Intronic
912347055 1:108973405-108973427 AAATATAAGCTCCATCAGGGAGG + Intronic
912607694 1:111008890-111008912 AAAGATAGGCTTCAGAAGATGGG + Intergenic
912885140 1:113463209-113463231 AAATCTAAACCTCAGAAGAGAGG + Intronic
914214743 1:145615309-145615331 AAATAAAAACTTCAGGGGAGAGG - Intronic
914466686 1:147935701-147935723 AAATAAAAACTTCAGGGGAGAGG - Intronic
914872273 1:151485038-151485060 AAATATAAGCTGGAGTAGAGTGG + Intergenic
915837030 1:159185410-159185432 AAATACATGCTTCTGCAGAGGGG + Intronic
916609084 1:166372544-166372566 AAAGAGAAGCTTCTGAAGAGAGG + Intergenic
917824414 1:178801895-178801917 AATTATAAGCTTCTTTAGAATGG - Intronic
917844311 1:179007676-179007698 AAATTGAAGCTTCAGTAATGAGG + Intergenic
922444721 1:225687486-225687508 CAAAATAAAATTCAGTAGAGTGG - Intergenic
923640680 1:235756696-235756718 AAATATAAGCTCCATGAGGGTGG - Intronic
1063714141 10:8510604-8510626 AATTATAACCTTAAGTAGAAGGG + Intergenic
1063798073 10:9535851-9535873 AAATAGAAGTGTCAGCAGAGGGG - Intergenic
1064970424 10:21060552-21060574 AAATATATGAGCCAGTAGAGGGG - Intronic
1065056339 10:21846596-21846618 AAATATAATATTCAGCAGATAGG + Intronic
1067808079 10:49407057-49407079 AGATAGATGCTTCAGTAAAGAGG + Intergenic
1068093043 10:52456252-52456274 AAACATACCCTACAGTAGAGAGG + Intergenic
1068551179 10:58409968-58409990 AAATATAAGCATCTGTGGAAGGG + Intergenic
1071008052 10:80906411-80906433 AGATGTAAGCTTAAGTAGTGAGG + Intergenic
1071390083 10:85165272-85165294 AAAAAAAACCTTCAGAAGAGAGG - Intergenic
1071427917 10:85578019-85578041 GAATGTAAGCCACAGTAGAGTGG + Intergenic
1071985340 10:91044705-91044727 AAATGTAAGGTTCAGTAGAAGGG - Intergenic
1073720421 10:106163174-106163196 AAATATAAAATCCACTAGAGAGG + Intergenic
1073887963 10:108063226-108063248 AAATAAAAACGTCAGTAGAGGGG + Intergenic
1075070236 10:119315458-119315480 GAAAATAAGCATCAGTGGAGGGG + Intronic
1076412086 10:130259105-130259127 AAATATTTGCTTTAGTATAGTGG - Intergenic
1078718864 11:13864979-13865001 GAATATAAGCTTCATAAGAGAGG - Intergenic
1078928985 11:15898970-15898992 AAATATAAGCTTCATGAGGGAGG - Intergenic
1079012748 11:16843039-16843061 AAATGTAAGCTACACGAGAGTGG + Intronic
1079577741 11:22024624-22024646 AAATAAAAAATTCACTAGAGGGG - Intergenic
1080302047 11:30795526-30795548 AAATATTAGTTTCAGGAGACTGG + Intergenic
1080382273 11:31785648-31785670 AAAAATAAGCTACTGGAGAGGGG + Exonic
1083691387 11:64411056-64411078 AAATATAAGCTCCATGAGGGTGG - Intergenic
1084370818 11:68741543-68741565 AAATGTAAGCTGCAGGAGGGCGG + Intronic
1086787309 11:90985075-90985097 AAATATAAGCTAAATTAGTGAGG + Intergenic
1086820127 11:91425539-91425561 AATTATAAGTTTGAGAAGAGGGG - Intergenic
1086872350 11:92053875-92053897 AAATAAAAGTTTTAGTAAAGAGG + Intergenic
1087489151 11:98801129-98801151 AAATTTAAGCCTCCTTAGAGAGG + Intergenic
1089881119 11:121774781-121774803 AAATATAAGCTCCATGACAGAGG - Intergenic
1090515693 11:127423982-127424004 AAAACTAACCTTTAGTAGAGGGG - Intergenic
1090813589 11:130269769-130269791 AAACAGAAGCATCATTAGAGAGG - Intronic
1094233029 12:28129909-28129931 ACATATAATCTCCATTAGAGAGG + Intergenic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1097449050 12:59713647-59713669 AAGTATATGCTTCAGGAGTGTGG + Intronic
1097635899 12:62121738-62121760 AAATGTAAGGTTCAGGAGATAGG + Intronic
1097764141 12:63504475-63504497 AAATATAAGATTAAATAGAATGG - Intergenic
1099015484 12:77339014-77339036 AAGTATGAGTTTCTGTAGAGAGG + Intergenic
1099048495 12:77754218-77754240 CAATATCAGCTTGAGGAGAGTGG - Intergenic
1099197424 12:79634300-79634322 AAAAATAATCTTCTGTAAAGTGG + Intronic
1099440727 12:82696569-82696591 AAATTTAAACTTAAATAGAGAGG - Intronic
1100511657 12:95280687-95280709 GAATATAAGCTCCATCAGAGTGG + Intronic
1100886927 12:99081643-99081665 AAAATTAAGCTTCTATAGAGAGG - Intronic
1101080813 12:101182107-101182129 AAATACCAGCTTGAATAGAGTGG - Intronic
1101796490 12:107979606-107979628 AAACTGAAGCTTCAATAGAGAGG - Intergenic
1103634002 12:122287335-122287357 AAACATACGCTTCAGTAGGTCGG + Intronic
1106700296 13:32221939-32221961 TAATGTAAGCTCCAGGAGAGTGG - Intronic
1107314212 13:39113645-39113667 AAATATAAGCTCCATGAGGGTGG + Intergenic
1107679320 13:42832002-42832024 AAATATAAGTTTGAATAGGGAGG - Intergenic
1107925775 13:45260426-45260448 AAATAGAAGCATTAGTTGAGGGG + Intronic
1108636579 13:52341062-52341084 GAACATAACCTTCAGAAGAGTGG - Intergenic
1108651475 13:52484493-52484515 GAACATAACCTTCAGAAGAGTGG + Intergenic
1109198173 13:59402220-59402242 AAAGTTAACCTTCAGTACAGTGG - Intergenic
1110743868 13:79029841-79029863 AAGGATAAGCTTCAATAGGGAGG - Intergenic
1111253435 13:85636136-85636158 AAATAGAACATTCAGTAAAGTGG - Intergenic
1111664283 13:91247423-91247445 AAATATATTCTTCAGAGGAGAGG + Intergenic
1117433098 14:55689519-55689541 AAATCTCAGCTTCAGTGCAGTGG - Intronic
1117947567 14:61045287-61045309 AAATAATGGTTTCAGTAGAGTGG + Intronic
1119389258 14:74279765-74279787 AAATAAAAAATTCACTAGAGGGG - Intergenic
1119493338 14:75056980-75057002 AAGTATAATATTGAGTAGAGTGG - Intronic
1120332935 14:83116608-83116630 AACAATAAGCTTCATGAGAGTGG - Intergenic
1120372691 14:83656972-83656994 AAAAATAAACTGAAGTAGAGAGG - Intergenic
1120624989 14:86813928-86813950 AAATCTTAGATTCAGTAGCGAGG - Intergenic
1121208992 14:92192398-92192420 AAATGTAAGCTCCATAAGAGCGG + Intergenic
1121476528 14:94212493-94212515 AAATTTAACCTTCAGATGAGTGG - Intronic
1125139738 15:36390859-36390881 GAATATAATTTTCAGTAGAGAGG - Intergenic
1126786863 15:52184299-52184321 AAAAACAGGCTTCAGGAGAGAGG + Intronic
1127059691 15:55169760-55169782 AAATATCCACTTCAGAAGAGTGG + Intergenic
1128015005 15:64336696-64336718 AAATATAACTTTCATTAGAGAGG + Intronic
1128291068 15:66478859-66478881 AAATTTAAGCTTCATGACAGTGG + Intronic
1129053628 15:72803694-72803716 AAACACAAACTTCAGAAGAGAGG - Intergenic
1131029556 15:89175044-89175066 AAAGATAAACTTCAGTCCAGAGG - Intronic
1134762920 16:16729891-16729913 AATTAAAAGCTTCACTAAAGGGG - Intergenic
1134983132 16:18629258-18629280 AATTAAAAGCTTCACTAAAGGGG + Intergenic
1137338814 16:47578110-47578132 AAATAAAAAGTTCAGTAGATAGG - Intronic
1138134981 16:54513607-54513629 AAAGATAAGCTTCTGAAGATTGG + Intergenic
1140329792 16:74043575-74043597 AAATTTAAAATTCAGTAAAGGGG + Intergenic
1140725893 16:77811876-77811898 AAATCAAAGCTTAGGTAGAGAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143296862 17:5877688-5877710 GACTATAAGCTTCATGAGAGTGG + Intronic
1143581147 17:7826937-7826959 AAATACAAGATTCAGAAGAGTGG - Intronic
1144608317 17:16687245-16687267 AAATGCAAGCCTCAGTAGAGTGG + Intergenic
1145196525 17:20899017-20899039 AAATGCAAGCCTCAGTAGAGTGG - Intergenic
1145744562 17:27305906-27305928 AAATATAAGCTCCAAGATAGTGG + Intronic
1146083725 17:29807728-29807750 AAAGATAAGCTGCAGGAGACAGG + Intronic
1147368821 17:39977253-39977275 AAATTTAAGCATCAGCAGATGGG - Exonic
1148251379 17:46083930-46083952 AAATACAAGCTGCAGAAAAGGGG + Intronic
1150200579 17:63352879-63352901 AAATATAAGCTTTAGGAGGATGG - Intronic
1150203757 17:63384427-63384449 ATATATAATCCTCAGAAGAGGGG + Intronic
1153377854 18:4400917-4400939 AAAAGTAAACTTCAGTAGGGAGG - Intronic
1154994284 18:21625219-21625241 AAATCTAAGATTCAGAAGCGTGG - Intronic
1155885427 18:31202228-31202250 ATATATAAAGTTCAGTTGAGAGG + Intergenic
1156922490 18:42539615-42539637 CAATATGAGCCTCAGCAGAGTGG + Intergenic
1157738895 18:50074778-50074800 AAATATAAGTTCCAGGAGATTGG + Intronic
1158554602 18:58465061-58465083 AAAGATAGGCTTCTGGAGAGAGG + Intergenic
1165703980 19:37961902-37961924 AAATAAAAAATTCACTAGAGGGG - Intronic
926021658 2:9501924-9501946 AAATATTAACCACAGTAGAGTGG + Intronic
926781312 2:16474855-16474877 AATTTTAAGCTTCAGGTGAGAGG + Intergenic
927326878 2:21815176-21815198 AAAGATATGCTTCAGTAGGAGGG - Intergenic
928345106 2:30485944-30485966 AAATATATGCTGAAGTAGAAAGG - Intronic
928784564 2:34866962-34866984 AGATAAAAGCATCAGTAGTGGGG + Intergenic
930656263 2:54010026-54010048 AAATACCAGGTTCAGTAGAATGG + Intronic
931287487 2:60844997-60845019 AAAAACAGGATTCAGTAGAGAGG - Intergenic
931631144 2:64300848-64300870 AAATAAAAAACTCAGTAGAGGGG + Intergenic
933131614 2:78679466-78679488 ACATAAAATCCTCAGTAGAGGGG - Intergenic
933343654 2:81054306-81054328 AAAGATAAACTTCAACAGAGAGG + Intergenic
934123647 2:88865262-88865284 AAATATAAACTGCTGTGGAGGGG + Intergenic
937811051 2:126199485-126199507 AAAAATCACCTTCAGTAGAGTGG - Intergenic
938208171 2:129441266-129441288 AAACACAGACTTCAGTAGAGCGG - Intergenic
940081918 2:149812688-149812710 AGATATAAGCTCCGGTGGAGCGG + Intergenic
940427926 2:153552158-153552180 AAAGAGAAGTTTCAGTGGAGTGG + Intergenic
940679658 2:156769962-156769984 AAATAAAAAATTCACTAGAGGGG + Intergenic
942041750 2:172072336-172072358 AAATTTATTCTTCAGTAGAAGGG + Intronic
943784206 2:191859209-191859231 AAAAATATGTTTCAGTAGAGTGG - Intergenic
945838404 2:214859420-214859442 AAATAAAACATTCATTAGAGAGG - Intergenic
946105223 2:217363302-217363324 AAATAAAAGCTCCAGAAGAGAGG + Intronic
946153050 2:217789205-217789227 TATTAAAAGCTTCAGTACAGCGG - Intergenic
948038018 2:234874949-234874971 AAAGATAAACATCAGAAGAGAGG - Intergenic
1168816872 20:743677-743699 AAATACAAACTCCAGTAGTGTGG - Intergenic
1169681310 20:8217104-8217126 AAATGTCACCTTCAGTAAAGTGG - Intronic
1170066222 20:12313415-12313437 AAATATAAGCTCCAGAAGAAGGG + Intergenic
1170732040 20:18984233-18984255 AAATTCTAGCTTCAGTGGAGAGG + Intergenic
1172218391 20:33253091-33253113 AAATAAAAAATTCACTAGAGAGG + Intergenic
1172521930 20:35572940-35572962 AAATTTAAAATTCACTAGAGAGG + Intergenic
1174960981 20:55156531-55156553 AAATAGTAGTTTCAGTAGATTGG - Intergenic
1175063165 20:56262322-56262344 AAATCAAAGCTTCAGTCTAGTGG - Intergenic
1175764692 20:61584164-61584186 ATATATGTGCGTCAGTAGAGAGG + Intronic
1178082676 21:29081120-29081142 AAATATAAGCCTGAGAAAAGAGG - Intronic
953341883 3:42141360-42141382 TAATATAAGCATCAGTACTGTGG + Intronic
953991019 3:47483570-47483592 AAATATAAGGTTTATTACAGAGG + Intergenic
956320049 3:67986431-67986453 AAATATAAGGTTTAGCACAGTGG + Intergenic
956623252 3:71241899-71241921 AAATATATGTTTTAGAAGAGAGG + Intronic
957263766 3:77934062-77934084 AAATTTTAGCTTCAGTTGATGGG + Intergenic
958028462 3:88077166-88077188 AAATATAAGAATCAGAATAGGGG + Intronic
958073116 3:88640347-88640369 AAAAATAAGCTTCAGAAGCTGGG - Intergenic
959156758 3:102675841-102675863 AAATATAATCTCCAAGAGAGTGG - Intergenic
959344020 3:105170070-105170092 AAATATAATGTTAAGTAGAGAGG - Intergenic
959469541 3:106732989-106733011 AAATATTACCTTCGGTAGAGTGG - Intergenic
959994960 3:112670321-112670343 AAGTACAAGCTGCAGAAGAGAGG + Intergenic
960742582 3:120851322-120851344 AAAAGTTAGCATCAGTAGAGCGG - Intergenic
962654413 3:137528543-137528565 AAATATATGATTCAATATAGAGG - Intergenic
964035530 3:152192126-152192148 AAATATAGGCTTTAGGAGCGGGG - Intergenic
964663449 3:159146744-159146766 AAATAAAAGCTTCAGAATAAAGG + Intronic
965190384 3:165520304-165520326 AAATGTAAGCTCCATGAGAGTGG - Intergenic
965252543 3:166361213-166361235 AAATATAAGCTTGAGTACAAAGG - Intergenic
965325548 3:167299439-167299461 AAATATAAGCTTCAGTAGAGTGG - Intronic
965338718 3:167459641-167459663 ATATTTAAGCTACAGTAGAAAGG - Intronic
966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG + Intergenic
969360800 4:6662553-6662575 AAATGTAAGCTTCATCAGGGCGG - Intergenic
970449922 4:16156492-16156514 GAATATAAGCTTCTAAAGAGAGG + Intergenic
973100803 4:46267240-46267262 AAATAAAAAATTCACTAGAGGGG - Intronic
974128070 4:57719815-57719837 AAATGTAAGCTCCATAAGAGCGG - Intergenic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
975834180 4:78404279-78404301 AAATATAGACTTCAGTATAAAGG + Intronic
978797526 4:112723190-112723212 AAACATAAGATTCAGTAAACAGG - Intergenic
979326670 4:119388339-119388361 AAATACAAGATTCAGAAGCGTGG - Intergenic
979517631 4:121628931-121628953 AACTATAAGCTTCAGCAGTGTGG - Intergenic
980174774 4:129331223-129331245 GAATATAAGGTTCAGAAGAATGG + Intergenic
980674747 4:136062404-136062426 AAATATAAGATGTAGTAGAATGG - Intergenic
982934662 4:161457193-161457215 AGATATAAGCTTGATTAGATAGG - Intronic
984115185 4:175671502-175671524 AAAAAGCAGCATCAGTAGAGTGG + Intronic
985254622 4:188057395-188057417 CAATATAAACTTCAGGAGAGTGG + Intergenic
985832745 5:2247471-2247493 AAATATAAGATGAAGAAGAGAGG - Intergenic
987299510 5:16585026-16585048 AATTATAAGCATCAGAGGAGAGG + Intronic
987612598 5:20225835-20225857 ACTTTTAAGCTCCAGTAGAGGGG + Intronic
987625972 5:20400864-20400886 AATTATAAGTTTCAGTATAAGGG - Intronic
988424772 5:31050992-31051014 ATACATAAGATTCATTAGAGAGG - Intergenic
989184881 5:38614138-38614160 ATAAATGAGCTTCAGTATAGAGG + Intergenic
989732639 5:44665782-44665804 GAATAAAAGTTTCAGTAGTGTGG - Intergenic
989797056 5:45488309-45488331 AAATATAAACTTCAGAAGAATGG + Intronic
990428916 5:55715436-55715458 AAATATAATGTTCACTGGAGGGG + Intronic
990603639 5:57385590-57385612 AAATAAAAGCTTCATGAGAAGGG + Intergenic
990633010 5:57691472-57691494 AAATATCGGCTGCAGTAGAGTGG + Intergenic
995407063 5:111810138-111810160 AAAAATAAGTTGGAGTAGAGAGG + Intronic
995809610 5:116090039-116090061 AAATAAAAGTACCAGTAGAGGGG - Intronic
995999487 5:118341586-118341608 AAAAAAAAGATGCAGTAGAGAGG + Intergenic
996332355 5:122344150-122344172 AAATGTAAGCTTCATGAAAGCGG + Intronic
996624505 5:125553865-125553887 AACTCTAACCTTCAGAAGAGTGG - Intergenic
999013990 5:148076820-148076842 AAATGAAAAGTTCAGTAGAGAGG + Intronic
999342681 5:150786224-150786246 AAATTTAAAATTCAGTAGATAGG - Intronic
999853725 5:155570575-155570597 AAATCTAAGGTTCAGGAGTGAGG - Intergenic
1001353001 5:170990374-170990396 AAATATAAACTTTAGTAGTGTGG + Intronic
1003295977 6:4828895-4828917 AAATAAAAAATTCACTAGAGAGG - Intronic
1007057716 6:38904289-38904311 ATATAGAAGTCTCAGTAGAGAGG + Intronic
1007801669 6:44399619-44399641 AAATGTAAACTTCACTAGAGAGG - Intronic
1010140141 6:72604550-72604572 ATATATAGGCTTCAAAAGAGAGG - Intergenic
1010788813 6:80038773-80038795 AAATTTAAGTTTTAGAAGAGTGG - Intronic
1014307198 6:119757742-119757764 AAATGAATGCTGCAGTAGAGTGG - Intergenic
1014812826 6:125905214-125905236 GAAGATCAGCTTCACTAGAGTGG + Intronic
1014823918 6:126026316-126026338 AGAAATATGCTTCGGTAGAGAGG - Intronic
1016394746 6:143611716-143611738 AAATATATGCTCCAGCAGCGTGG + Intronic
1016564380 6:145436804-145436826 AAATAAAAAATTCACTAGAGAGG - Intergenic
1016730996 6:147427490-147427512 AAATAAAAGCATCAGTACATAGG + Intergenic
1018644892 6:165938893-165938915 AAATAAAATCTTTAGTAAAGTGG + Intronic
1020855060 7:13409891-13409913 AAATACAAGCTTCAAAATAGTGG + Intergenic
1020983248 7:15098044-15098066 AAATATAATCTTTAGTATATGGG + Intergenic
1023225784 7:37967394-37967416 AAATAGTAATTTCAGTAGAGAGG - Intronic
1023228694 7:38000695-38000717 AACAATAAACTTCAGTAAAGAGG + Intronic
1024103115 7:46053664-46053686 AAATATAAAATTCACTAGAGAGG - Intergenic
1024106945 7:46099660-46099682 AAATATTACCTTCAAAAGAGTGG - Intergenic
1028813843 7:95121328-95121350 AATTAAAATCTCCAGTAGAGGGG + Intronic
1030433624 7:109486407-109486429 AAATAGAAGTTTGAGGAGAGAGG + Intergenic
1032998086 7:137470758-137470780 AAACATAAGCTTCAGGAGTTTGG - Intronic
1033111695 7:138584567-138584589 AAATAAAAGATTCAGAAGTGTGG - Intronic
1035549313 8:508224-508246 AAATAAAATATTCACTAGAGGGG + Intronic
1038470650 8:27815476-27815498 ATATATAAGGTACAGTATAGGGG - Intronic
1038558962 8:28552707-28552729 AAATATAAACTTTATTAGTGAGG - Intronic
1038744342 8:30243902-30243924 AAATAAAAAATTCATTAGAGGGG + Intergenic
1039497369 8:37990969-37990991 AAATATAAGCTCCAGCACAGTGG - Intergenic
1041004997 8:53488938-53488960 AAAGAGAAGTTTCAGTGGAGTGG - Intergenic
1041407493 8:57516170-57516192 GAGCAAAAGCTTCAGTAGAGAGG - Intergenic
1041509194 8:58635997-58636019 AATCATAACCTTCAGTAGAATGG - Intronic
1042070143 8:64924076-64924098 CAATTTAAGACTCAGTAGAGGGG + Intergenic
1042439103 8:68804522-68804544 AACTATAACCTTCAATTGAGAGG + Intronic
1043131106 8:76462455-76462477 CAATATAACCTTGAGTACAGAGG + Intergenic
1046146215 8:110162685-110162707 AAATATAAGCTTTAAAAAAGAGG - Intergenic
1050269316 9:3925321-3925343 GAATGTAATCTTCAGGAGAGTGG + Intronic
1054737961 9:68774974-68774996 AAATATAAAATTTACTAGAGAGG - Intronic
1055185210 9:73443293-73443315 AAAAATAAGATTCAGTACAAAGG - Intergenic
1055265275 9:74488367-74488389 AAATAAATGCCTCAGTAGATAGG + Intergenic
1055288839 9:74761403-74761425 AAATTTAAGAGTCATTAGAGTGG - Intronic
1056080561 9:83090131-83090153 AAATGCAAGATTCACTAGAGGGG - Intergenic
1056850769 9:90081857-90081879 AAATATAAGTTCCAGGAGTGGGG + Intergenic
1058096497 9:100866372-100866394 AAATCTAAGCTCCAGAAGGGTGG + Intergenic
1058147483 9:101428121-101428143 AAAAATTAGCAGCAGTAGAGTGG - Intronic
1058165459 9:101613870-101613892 ATATTTAAGGTTCAGAAGAGGGG - Intronic
1058254119 9:102739400-102739422 AAATATAATCTTTAGAAGTGGGG - Intergenic
1058435506 9:104958837-104958859 AAATATAATCTGAACTAGAGAGG - Intergenic
1058538535 9:105988848-105988870 AAATGTAAGTTTTGGTAGAGGGG - Intergenic
1058887935 9:109336959-109336981 AAATATAACCTCCAGTAGCATGG + Intergenic
1059795306 9:117688305-117688327 AAATAGAACATTCACTAGAGGGG + Intergenic
1061230177 9:129311294-129311316 AATTAAAAGCTTCAGGGGAGTGG + Intergenic
1061691931 9:132340124-132340146 AAATAAAGGCTTCAGAAGATGGG - Intronic
1061756622 9:132817216-132817238 GAAAATAAGCTTCAGTAGGATGG + Intronic
1186224086 X:7378723-7378745 TAATACAGACTTCAGTAGAGGGG - Intergenic
1187326138 X:18291025-18291047 AAATATAAGATACAGAAGAGGGG + Intronic
1190772992 X:53530600-53530622 AAAAAAAAATTTCAGTAGAGAGG + Intergenic
1194111306 X:89837912-89837934 AAAAGTAAACTTCAGCAGAGAGG + Intergenic
1194146243 X:90268472-90268494 AAACACAAGATTTAGTAGAGTGG + Intergenic
1194999841 X:100633000-100633022 AAATATAAGCTGAAATAGATAGG - Intronic
1196816008 X:119666088-119666110 AAAAAAAAGAGTCAGTAGAGAGG + Intronic
1197632237 X:128874816-128874838 AAATATAAAATTCAGAACAGTGG - Intergenic
1199838576 X:151619741-151619763 AGATATAAACTTCATTAGTGTGG + Intronic
1200463966 Y:3492655-3492677 AAAAGTAAACTTCAGCAGAGAGG + Intergenic
1200491985 Y:3837743-3837765 AAACACAAGATTTAGTAGAGTGG + Intergenic