ID: 965326460

View in Genome Browser
Species Human (GRCh38)
Location 3:167310228-167310250
Sequence CAAAATGCTTATAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 3, 2: 62, 3: 104, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965326460_965326462 4 Left 965326460 3:167310228-167310250 CCATTATCACTATAAGCATTTTG 0: 1
1: 3
2: 62
3: 104
4: 309
Right 965326462 3:167310255-167310277 AAATCATTCAACAAGTCTCTAGG 0: 29
1: 513
2: 2153
3: 1968
4: 1454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965326460 Original CRISPR CAAAATGCTTATAGTGATAA TGG (reversed) Intronic