ID: 965326460

View in Genome Browser
Species Human (GRCh38)
Location 3:167310228-167310250
Sequence CAAAATGCTTATAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 3, 2: 62, 3: 104, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965326460_965326462 4 Left 965326460 3:167310228-167310250 CCATTATCACTATAAGCATTTTG 0: 1
1: 3
2: 62
3: 104
4: 309
Right 965326462 3:167310255-167310277 AAATCATTCAACAAGTCTCTAGG 0: 29
1: 513
2: 2153
3: 1968
4: 1454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965326460 Original CRISPR CAAAATGCTTATAGTGATAA TGG (reversed) Intronic
905881457 1:41466910-41466932 CCAAAAGCATATAGGGATAAGGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909527042 1:76636694-76636716 CAAAATTCTATTAGTGTTAAGGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912171337 1:107103403-107103425 CAAAAGGCACATAGTGAAAAGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912428626 1:109616357-109616379 CAAAATGATAATGGTTATAAAGG - Exonic
914784088 1:150812542-150812564 CATAATGATTATAGCCATAATGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917846203 1:179022616-179022638 GAAAATGCTTACAATGATGAAGG + Intergenic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
919122414 1:193357674-193357696 CAAAATGCCTAGAATTATAATGG + Intergenic
919127135 1:193408779-193408801 CAAAGTTGTTATAGTGATCAAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920790863 1:209089900-209089922 CAAAATGCTTAAAGAAATAATGG + Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921553715 1:216570571-216570593 CAAAATTCTTATAATGAAAGAGG - Intronic
921833673 1:219756418-219756440 CATAATTTTTATTGTGATAATGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922038587 1:221873880-221873902 CAAAAGGCTTACAGAGAAAAGGG - Intergenic
922563129 1:226583433-226583455 CAGATTGATTATAATGATAATGG + Intronic
924717176 1:246586908-246586930 AAAAATGATTATAGTGGTTAAGG + Intronic
1062868127 10:874841-874863 CATAATGATTATGATGATAATGG + Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066254838 10:33668552-33668574 CAAAATGCTTTTATTGTCAAAGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066809100 10:39301959-39301981 AAAAATGCCTACATTGATAAAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068060120 10:52057339-52057361 CAGAATGCTTGCAGTGATGATGG + Intronic
1068193990 10:53692137-53692159 AAAACTGCTTCTAGTCATAACGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1071007580 10:80900567-80900589 CAAAATGCCAATAGTGCTGAGGG + Intergenic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073823601 10:107293140-107293162 CGAAGTGCTTATAGTGAGAGAGG - Intergenic
1074391284 10:113060181-113060203 AAAAATGCATTTAGTGATAAAGG + Intronic
1074979156 10:118605477-118605499 CAATATGATTTTAGAGATAAGGG - Intergenic
1075151548 10:119937227-119937249 AAAAATACTTATAATGACAAAGG - Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078950982 11:16134029-16134051 AATAATGATTATAGTAATAAAGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1080132167 11:28809165-28809187 GAAAATGCTTATTTTTATAAGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080281998 11:30567989-30568011 GAAAAAACTTATAGTGATGATGG + Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082111024 11:48274087-48274109 GGAAATGCTTAAAGTGTTAAGGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084449336 11:69226026-69226048 AAAAATGCTTACAGAAATAATGG - Intergenic
1084687038 11:70702605-70702627 GATAATGATTACAGTGATAATGG - Intronic
1085519471 11:77129660-77129682 CATAATGCATATAGTCAAAATGG + Intronic
1085695477 11:78701041-78701063 CAAAATGGTTAAAATGAAAAGGG + Intronic
1085964553 11:81505768-81505790 CAAATTGCCTATATTCATAATGG - Intergenic
1086493864 11:87382984-87383006 CAAACTCCTTATAGGGATATAGG - Intergenic
1086756129 11:90564525-90564547 TAAAATACTTCTAGAGATAATGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087029525 11:93688963-93688985 CAAAAAGCTTATAGTCATTCTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090603308 11:128394813-128394835 CATGAAGCTTATATTGATAAGGG - Intergenic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1090944499 11:131417875-131417897 CAAAATGCTTACACTGCCAAAGG - Intronic
1091534856 12:1396769-1396791 CAAAATGCCTATACAGAGAATGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094877326 12:34665025-34665047 AAAAATGCCTATGGTGAAAAAGG + Intergenic
1094877350 12:34665532-34665554 CACAAGGCTTACAGTGAAAAAGG + Intergenic
1094878226 12:34676830-34676852 AAAAGTGCTTATGGTGAAAAAGG + Intergenic
1095072831 12:37877409-37877431 CAAGAGGCCTATAGTGAAAAAGG - Intergenic
1095074732 12:37904392-37904414 CAAAAAGCCTATGGTGAAAAAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097487688 12:60226326-60226348 AAAAATGCTCAAAGAGATAAAGG + Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097949167 12:65407618-65407640 GAAAATGTTTAAAGTAATAATGG - Intronic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1098754127 12:74336524-74336546 CAAAATGCATTGAGTGATAGAGG - Intergenic
1099478020 12:83132094-83132116 CAAAATGCCTCTAGACATAAGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099828587 12:87811443-87811465 CCAAATATTCATAGTGATAAAGG + Intergenic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1100994251 12:100285240-100285262 CAAAATTATTCTAGTGTTAAAGG - Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105283085 13:18980972-18980994 GAAAATGCTAAGAGTAATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106393403 13:29357872-29357894 CTAAATGCTTCTAGTGGTTAAGG - Intronic
1107811383 13:44203202-44203224 CAGAATGCTTATATAAATAATGG - Intergenic
1109030291 13:57181327-57181349 CATAGTGATCATAGTGATAATGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109438721 13:62341352-62341374 CAAAATGCTAAGATTGATCACGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110267498 13:73555017-73555039 CAAATTGCATTTAGTGATCATGG - Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111174963 13:84582245-84582267 CAAATGGCTTAAAGAGATAAAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112531178 13:100205116-100205138 CAAAAAACTTACAGTGATTAAGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115031594 14:28802410-28802432 CATAATACTTTTATTGATAATGG + Intronic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117350496 14:54876996-54877018 CTAAATGCTTCATGTGATAATGG + Intronic
1117402225 14:55368831-55368853 CAAAATGCTCATAGTGTGGATGG + Exonic
1117701303 14:58416385-58416407 CAAAATGTTTCAAGTGCTAAAGG + Intronic
1118042252 14:61930116-61930138 CAAGATGCTTATATTCATAAAGG + Intergenic
1118475238 14:66110046-66110068 CAAAATGCTTACTGTGGTGAGGG + Intergenic
1118561809 14:67093284-67093306 CAAAATGCTAATAGTGGCCAGGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120687190 14:87551029-87551051 AAAAAGTCATATAGTGATAAAGG + Intergenic
1121626173 14:95386866-95386888 CAAACTGGTTAAAGTGAAAAAGG + Intergenic
1122434654 14:101687027-101687049 CAAAATGTTTAAAGGAATAAAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1125774658 15:42201349-42201371 AAAAATGTTTATAGAGATGAGGG + Intronic
1126224004 15:46248702-46248724 TAATATGATTATTGTGATAATGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127355137 15:58191074-58191096 CAAAATGCTTATACTTCAAATGG + Intronic
1129290828 15:74566006-74566028 CTGAATTCTTATAGTGAGAAAGG - Intronic
1130186589 15:81689318-81689340 CAAAATGCTTCAAGAGATATGGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131531660 15:93198824-93198846 CAAAATGGCTATAGAGATCATGG - Intergenic
1133142328 16:3755732-3755754 TAAAATGTTTCTATTGATAAAGG + Intronic
1134312332 16:13086603-13086625 CAAAATGGTACTAGTGAAAATGG + Intronic
1134390455 16:13815297-13815319 GAAACTGCTTATAGTCAAAACGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1136495819 16:30643340-30643362 AAAAATTTTTATAGAGATAAGGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137939165 16:52665952-52665974 AAAAATGCTTAATGTGATATTGG - Intergenic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139081941 16:63532463-63532485 CAAAATGCTTATAGTACAAAGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143806569 17:9433408-9433430 AGAAAAGCTTATAGTGATGAAGG - Intronic
1149082593 17:52677038-52677060 GTAGATGCTTACAGTGATAATGG - Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149471342 17:56917614-56917636 CAAAATGATCATAGTTATTATGG - Intergenic
1150969800 17:70015021-70015043 CTAAATGATTATTGTGAGAACGG - Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1155314156 18:24554594-24554616 CAAAATGCATAAAGTTGTAAGGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156409378 18:36813009-36813031 CAAAATAATTACAGAGATAACGG + Intronic
1159361279 18:67406776-67406798 AAAAATGCTTACATTTATAATGG + Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1161985062 19:7648514-7648536 CAAAATGGTTCCAGTGAAAATGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166088151 19:40490413-40490435 CAAAATGATTATCGTGATGGTGG - Intronic
1166634035 19:44433619-44433641 CAGAAAGCTTACAGTCATAATGG - Intronic
1168301932 19:55409833-55409855 CAAAATGCTTATCGGCAAAATGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925205353 2:2001157-2001179 AAAAAAACTAATAGTGATAAAGG - Intronic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925685214 2:6464293-6464315 GAAAATCCTTTTAGTTATAAAGG - Intergenic
926049410 2:9734687-9734709 CAAAATAGAAATAGTGATAAAGG - Intergenic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930127195 2:47810823-47810845 GGAAATGATTATAGTAATAAGGG - Intronic
930436161 2:51345265-51345287 TAAAATGCCTTTAGTAATAATGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933067839 2:77820089-77820111 AAAAATACTTATTGTGATACAGG - Intergenic
934094790 2:88590886-88590908 CATAATGGACATAGTGATAAAGG - Exonic
934163874 2:89276518-89276540 CAAAATTATTAAAGTGAGAAAGG - Intergenic
934203398 2:89906006-89906028 CAAAATTATTAAAGTGAGAAAGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
937835333 2:126465712-126465734 CAAAATGCTTGGAGTTCTAAGGG + Intergenic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
939435159 2:142166853-142166875 CAAAATGCCTATTATCATAAAGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940078468 2:149771022-149771044 CAAAATGTTTTTATGGATAAGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941541097 2:166785602-166785624 AAAAATGTTAATAGAGATAAGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942761938 2:179409951-179409973 CAAAATACTTAGAGTTAAAAAGG + Intergenic
942838870 2:180335965-180335987 CAAATAGCTTAGAGTGATAAAGG - Intergenic
943175740 2:184471805-184471827 CAAAATGCTTAAACTAATGAGGG + Intergenic
943224978 2:185161156-185161178 CAAATTACTTAAAGTGATAAGGG + Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
944103062 2:196049990-196050012 AAATATGCTTTTATTGATAATGG - Intronic
944474092 2:200086378-200086400 CAAAATGTTTATATAGACAAGGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945953182 2:216059744-216059766 CAACATGATTATAGTCATTAGGG - Intronic
946467734 2:219927260-219927282 CAAATAGCTTATCCTGATAACGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1172712343 20:36935544-36935566 CATAATACCTATAGTGATATGGG - Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177782790 21:25639062-25639084 CAAAAAGCTTAAACTGAGAAGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1184908847 22:47512095-47512117 CAAAAGGATTATTGTGATAAAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
952094399 3:29931423-29931445 CAAAATGCTTACAAAGTTAAAGG + Intronic
952252812 3:31671240-31671262 CAAAATTGTAACAGTGATAAAGG + Intronic
952650320 3:35718920-35718942 AAAAATGCATATAGACATAAAGG + Intronic
955792554 3:62603722-62603744 CAATATGCTTAGAGTTCTAATGG - Intronic
956287958 3:67630434-67630456 CTAAATGCTTATAGCGTTAATGG - Intronic
956340416 3:68216840-68216862 CAAAATGAATAAAGTGATATGGG + Intronic
956838868 3:73118420-73118442 CAAAAAGATAATAGTAATAATGG - Intergenic
957444267 3:80294707-80294729 CAAAATGCTTTCCGTGATCAGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958271570 3:91506289-91506311 CAAGATGCTTATATTTTTAAGGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960252886 3:115476071-115476093 CAAAATGCTTATGGTTGCAAAGG + Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963149369 3:142028943-142028965 AAAAATGCTTAAAGTAAAAAGGG + Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963788095 3:149555862-149555884 CAGAATAATTTTAGTGATAAGGG + Intronic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965319707 3:167237836-167237858 CAAAATTCTTATATTGTAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966429252 3:179814174-179814196 CAAAAGGCTTACAGTGAAATGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966996800 3:185290326-185290348 CTAAAATATTATAGTGATAAAGG - Intronic
967438818 3:189482520-189482542 CAAAATATTTGTAGTAATAATGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970742940 4:19259263-19259285 GAAAAAGCTTATAGAAATAAAGG + Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971895323 4:32585706-32585728 AAAAATGCTTATACTAATTATGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973011977 4:45087485-45087507 CAAAATGCATATATTAATTATGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974295308 4:59990994-59991016 CAAAATACTTTTAGCTATAATGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979376806 4:119956110-119956132 AAAAATGCTTTAAGTAATAATGG - Intergenic
979382568 4:120025009-120025031 AAAAATGCTTGAAGTAATAACGG + Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979933639 4:126664594-126664616 CAAAACACATATAATGATAAAGG - Intergenic
980891841 4:138823946-138823968 CAAAATGCTTTCAGGGCTAAAGG + Intergenic
981048031 4:140283442-140283464 AAAAATGCTTGTAGTGTTATAGG - Intronic
981109065 4:140914710-140914732 CAAAATGCTTCTGATAATAAAGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981534853 4:145788439-145788461 TAAAATGATTATTGTTATAATGG - Intronic
981729890 4:147886186-147886208 CAAAATGCTTGCAATGAGAAGGG - Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982915701 4:161205727-161205749 CAAAACACTTATATTCATAATGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983416715 4:167465935-167465957 CAATATGAATATAGTGATATTGG - Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984599879 4:181713849-181713871 CTAAATGCTTACGGTGATCAAGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986120235 5:4828487-4828509 TATAATGTTTATAGTGATAGAGG - Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988649181 5:33129705-33129727 CAAAATACTTTAAGTGCTAAAGG + Intergenic
988719057 5:33858348-33858370 CAAAATGCTTACAGTAGAAAAGG + Intronic
988876399 5:35451635-35451657 AAAAAAGCCTATAGTGATGAAGG + Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989838101 5:46021051-46021073 AAAAATGCCTATGGTGAGAAAGG + Intergenic
989838956 5:46035280-46035302 CAAAAGGCCTATGGTGAAAAAGG + Intergenic
989839110 5:46038021-46038043 CAAGATGCCTATGGTGAAAAAGG + Intergenic
989841289 5:46074694-46074716 CAAAAAGCTTATGGTGAAAAAGG + Intergenic
989855737 5:46287534-46287556 CATAAGGCTTATGGTGAAAAAGG - Intergenic
989857728 5:46319066-46319088 CAAAAAGCCTATAGTGAACAAGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992715921 5:79511330-79511352 TAAACTGCTTAGAGTGAAAAAGG + Intronic
992994132 5:82315913-82315935 TAAAATGCTCATTGTGATGAAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993085631 5:83360261-83360283 CAAGATGATTGTAGTGATGATGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994261724 5:97667228-97667250 CAAAATGCTTCCAGTGTCAATGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
996230058 5:121052321-121052343 CCAAATGATTATAAGGATAAGGG - Intergenic
997959928 5:138312810-138312832 GAAAATGGTTATGATGATAAAGG + Intronic
998629109 5:143878659-143878681 CAAAATGCACAAAGTAATAAAGG - Intergenic
1000512570 5:162201749-162201771 CAAAATGCCACTAGTGATGATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1001891026 5:175338760-175338782 TAAAATGTATGTAGTGATAATGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1004988204 6:21106885-21106907 CAAATTGCTTATGGTGGTTATGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007951206 6:45873974-45873996 CAAGATGCTTTTAGTCCTAAAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1008469309 6:51865470-51865492 CAAATAACTTATAGTGAAAATGG + Intronic
1008469572 6:51868553-51868575 CAAAATGCCAATAGTGCCAAGGG + Intronic
1009409049 6:63344217-63344239 GAAAATGAATACAGTGATAAAGG + Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009802540 6:68558154-68558176 CAAAACATTTATATTGATAAAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013448236 6:110252586-110252608 AAAAATGCTTATGGAGATAGTGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015915487 6:138212025-138212047 CAAAATGCTTAAAAAGATAAGGG + Intronic
1015973688 6:138768292-138768314 CAAAATACTTAAATTGGTAAGGG + Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1017929578 6:158940020-158940042 CCAAATGCTAATGGTGACAAAGG + Intergenic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021321096 7:19212421-19212443 CAAAAAAATTATAGTTATAAAGG - Intergenic
1021494209 7:21255955-21255977 CAAAATGATTATACTGTTTAAGG - Intergenic
1022185908 7:27968658-27968680 CAGAATGCTTTTAATAATAAAGG - Intronic
1022562134 7:31360616-31360638 CACAATGCTTAATGTGATACTGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1026796620 7:73369872-73369894 GAAAATGCTAACAGTGAGAAGGG - Intergenic
1027578844 7:79967044-79967066 CATAATGTTTATCGTGAAAAAGG - Intergenic
1027742054 7:82021099-82021121 CTAAATGCATATAGAGAAAAAGG - Intronic
1028166269 7:87541324-87541346 CAAAATGAATATAGTGAAAATGG + Intronic
1029434923 7:100558304-100558326 CAAAATTTTTAGATTGATAATGG + Intronic
1030367468 7:108661718-108661740 CAAAATGGGAAGAGTGATAAAGG + Intergenic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1031178767 7:118388417-118388439 TAAAAAGCTTATGGTGAAAATGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031320433 7:120319771-120319793 CAAAATGTTTATATTAAGAATGG - Intronic
1031690760 7:124784725-124784747 CATAATGCTTTTAGTAAAAAAGG + Intronic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033037467 7:137888265-137888287 CAAAATGCTTTTAAAGAAAATGG - Intronic
1034079736 7:148265445-148265467 TAAAATTTTTATAGAGATAATGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041197254 8:55412427-55412449 CAAAATCCTTGAAGTGACAATGG + Intronic
1041430005 8:57769182-57769204 TAAAATGCATATTGTAATAATGG + Intergenic
1041546792 8:59054757-59054779 CCACAAGCTCATAGTGATAAAGG + Intronic
1041679513 8:60574288-60574310 CATAATGCTTATTCTGAGAAGGG - Intronic
1041958279 8:63581875-63581897 CAAAATGATTATGGTGCAAATGG + Intergenic
1042391771 8:68244239-68244261 TAAAATGCTTTTCATGATAAAGG + Intergenic
1043315147 8:78911286-78911308 CAAAATGTTAATAGTGAACATGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044928952 8:97233672-97233694 CCAAATACTAATAATGATAATGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045322172 8:101090611-101090633 TAAAATTCAAATAGTGATAAGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046401262 8:113706771-113706793 AAAAATGTTTTTAGTGATTAAGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048167678 8:132077787-132077809 CAAAAGGCTTGTAGTGTTCATGG + Exonic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050040241 9:1484033-1484055 CAAACGTCATATAGTGATAAAGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052510890 9:29418593-29418615 TAAAATCCTTTTGGTGATAAGGG + Intergenic
1055108099 9:72533239-72533261 TATAATGCATAAAGTGATAAAGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055230386 9:74057205-74057227 TAAAATGCATGTAGTGATAATGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060162119 9:121373449-121373471 CAAATTGCATATTGTGAAAAAGG + Intergenic
1060824270 9:126678974-126678996 CAAAATCCTTAAAGTCATAATGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1203654845 Un_KI270752v1:13832-13854 CAAAATGATTGTAGGGATAGGGG - Intergenic
1186759997 X:12713277-12713299 AAACATGCTTACAGTAATAAGGG + Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189350004 X:40269082-40269104 CAAAATGCTTTTGGTTATATTGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189974703 X:46449158-46449180 CAAAATGCAAATTGTGAGAAAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191267778 X:58418666-58418688 CAAAATGCCTAGAGTGAAAAAGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194112090 X:89847097-89847119 CAAAATAATTACGGTGATAAGGG + Intergenic
1194178024 X:90676148-90676170 CAAAATGATTAAAGTGAATATGG + Intergenic
1194712084 X:97247844-97247866 CAAAATGCTTAAATAAATAAAGG - Intronic
1195563384 X:106311681-106311703 CAGAATTCGTATTGTGATAATGG + Intergenic
1196362799 X:114886004-114886026 CAAAATGCATGAAGTGAAAATGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198929246 X:141836195-141836217 CAAAATGTCAATAGTAATAAAGG - Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200464743 Y:3501877-3501899 CAAAATAATTATGGTGATAAGGG + Intergenic
1200524691 Y:4258305-4258327 CAAAATGATTAAAGTGAATATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic