ID: 965327470

View in Genome Browser
Species Human (GRCh38)
Location 3:167324890-167324912
Sequence TTGTAGAAGAAGAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965327470 Original CRISPR TTGTAGAAGAAGAAGTTGGA AGG (reversed) Intronic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
904101013 1:28027238-28027260 TGTTAGAGGAAGAACTTGGAAGG + Intronic
905261894 1:36725330-36725352 GTGTGCCAGAAGAAGTTGGAAGG + Intergenic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
905920660 1:41716575-41716597 TTGTAGGAGGAGCAGTGGGAGGG + Intronic
905951669 1:41956819-41956841 ATGGAGGAGAAGGAGTTGGAAGG + Intronic
906751972 1:48272374-48272396 TCATAGAAGTAGAAGTAGGATGG - Intergenic
906848143 1:49216958-49216980 TTGTATGAGAAGAGGTTGCAAGG - Intronic
907587681 1:55635589-55635611 TTAGAGAAGAAGGACTTGGATGG + Intergenic
908394062 1:63709141-63709163 TTGTAGGGGAAGAACTAGGATGG + Intergenic
908887620 1:68808237-68808259 TTATAGCAGCAGAAGTTTGAGGG + Intergenic
909711472 1:78654576-78654598 CTGTAGAAGAAGTGGTTGGTGGG + Intronic
909725522 1:78830213-78830235 TGGTAGAGGAAGAATTTTGATGG + Intergenic
910195762 1:84638116-84638138 TTGTGGAAGTAGGGGTTGGAAGG + Intergenic
910452315 1:87359840-87359862 TTATATAGGAGGAAGTTGGAGGG + Intergenic
910598608 1:89006022-89006044 GGGTAGAGGAAGCAGTTGGAAGG - Intergenic
910825348 1:91401221-91401243 TTGCAGACGATGAAGCTGGAAGG - Intronic
911046808 1:93635576-93635598 GTGGAGTGGAAGAAGTTGGATGG + Intronic
911306667 1:96240659-96240681 TTGCAGAAGCATAAGTTAGATGG + Intergenic
911786463 1:101955528-101955550 TTTAAGAAGTAGAAGATGGATGG - Intronic
911808901 1:102248122-102248144 CTGAAGAAGAATAAGTTGCATGG - Intergenic
912535393 1:110364820-110364842 TTTTAAAAGCATAAGTTGGAGGG + Intronic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
916523463 1:165587177-165587199 TTATAGAATAAGAAATTAGATGG - Intergenic
917662261 1:177188548-177188570 GACTAGAAGAAGAAGTTGGGAGG + Intronic
917811012 1:178658459-178658481 TAGTAGGAGATGAAGATGGATGG - Intergenic
918251286 1:182705835-182705857 TTATAGAAGAAGCTGTTGAACGG - Intergenic
922078330 1:222269676-222269698 GTATAGAAGAAAAGGTTGGAGGG + Intergenic
922345520 1:224693207-224693229 TTGCTGAACCAGAAGTTGGAGGG + Intronic
922880916 1:228979663-228979685 TTGGAGCAGAAGAAGTTGAGAGG + Intergenic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
923779368 1:237008542-237008564 GGGTAGACGAAGAACTTGGAGGG - Intergenic
924082211 1:240411062-240411084 TAATACAAGAAGAAGTAGGATGG - Intronic
1063920541 10:10927820-10927842 TTGCAAAAGAGGAAGTGGGAAGG - Intergenic
1066648410 10:37634116-37634138 TTGGAGCAGAAGAAGTGGAAGGG + Intergenic
1067121087 10:43472805-43472827 TTATAACAGAATAAGTTGGAAGG - Intronic
1067264733 10:44730237-44730259 TTGCTGAAGAAGAATTTAGATGG + Intergenic
1067488751 10:46677952-46677974 TTTTAGGAGAAGCAGGTGGATGG + Intergenic
1067540372 10:47146570-47146592 TTGCAGAAGAACATGTGGGAAGG - Intergenic
1067605918 10:47662424-47662446 TTTTAGGAGAAGCAGGTGGATGG - Intergenic
1068242963 10:54328580-54328602 GTCTAGAAGGAGATGTTGGATGG + Intronic
1069252693 10:66290098-66290120 TAGTAGTAGGAGAAGTTGGGTGG + Intronic
1070382276 10:75891736-75891758 TTTTAGAAGAAAGAGTTGAAAGG + Intronic
1071110027 10:82144974-82144996 TTTTAAAAGAAAAAGTGGGATGG - Intronic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1071621473 10:87123783-87123805 TTTTAGGAGAAGCAGGTGGATGG - Intronic
1071844444 10:89506652-89506674 TTGTAGGAGAAGAAGCTGTCTGG - Intronic
1071885324 10:89943558-89943580 TTGGAGAATAAGAAGTGGAAGGG - Intergenic
1072033189 10:91540657-91540679 TTGTAGAAGAGAATGTAGGATGG - Intergenic
1072158343 10:92743919-92743941 TTGTAGGAGAAGTAGGGGGAGGG + Intergenic
1073083263 10:100873045-100873067 TTGGGGCAGAAGAAGTTCGAGGG + Intergenic
1073166989 10:101463681-101463703 TTATAGATGAAGAAAATGGAGGG + Intronic
1074416322 10:113270015-113270037 TTTTAAAAAAGGAAGTTGGAAGG + Intergenic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1074948839 10:118308531-118308553 TAGCAGAAGAAGGGGTTGGAGGG - Exonic
1075594766 10:123720915-123720937 TGGTGGAAGAAGATGGTGGAAGG + Intronic
1075833943 10:125436996-125437018 TTGTAGATGATGATGATGGATGG - Intergenic
1078489288 11:11754478-11754500 TTGTAGAAGGATGACTTGGAAGG - Intergenic
1078552825 11:12292234-12292256 TGGTTGAAGAAGAAGATGGTGGG - Exonic
1079782674 11:24627839-24627861 TTGGAGAAGAGTAAGCTGGAGGG - Intronic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1081955051 11:47084770-47084792 TTGAAAAAGAAAAAGTTGAAGGG - Intronic
1081982637 11:47278201-47278223 TTGTAGAGGAAGAAGCTGGCAGG - Exonic
1082109294 11:48256493-48256515 TTTAAGAACAAGCAGTTGGACGG + Intergenic
1082637031 11:55608820-55608842 TTGAAGAAAAAGAAGTTTAATGG - Intergenic
1084049722 11:66591913-66591935 ATAAAGAAGATGAAGTTGGAGGG - Exonic
1084537241 11:69764406-69764428 GGGTAGAGGAAGAAGTTGGGGGG + Intergenic
1085629191 11:78099134-78099156 AAGTAGAAGATGAATTTGGATGG - Intergenic
1085664356 11:78400286-78400308 TTGGTGTGGAAGAAGTTGGAGGG - Intronic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085831201 11:79902849-79902871 TTGGCAAAGTAGAAGTTGGAGGG - Intergenic
1086138972 11:83473425-83473447 TTGTAGCAGATGACATTGGAGGG - Intronic
1086877038 11:92109814-92109836 TTGAATAAGAAGAAATTGGCAGG - Intergenic
1087530608 11:99376365-99376387 TCTTAGAAGAAGAAGATGCATGG - Intronic
1087549748 11:99634161-99634183 TGGTTGAAGAAAAAGTTGTAAGG + Intronic
1088087672 11:106001097-106001119 TTGTGGTAGGAGAACTTGGAGGG + Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088896590 11:114083227-114083249 TTTTAAAAAAAGAAGTTGAAAGG + Intronic
1088915931 11:114227740-114227762 TTGCAGATGGAGAAGTTTGAGGG + Intronic
1089883573 11:121797771-121797793 TCCCAGAAGAAGGAGTTGGAAGG + Intergenic
1090543685 11:127737727-127737749 TGGTAGAACAATAACTTGGAGGG - Intergenic
1090563621 11:127961963-127961985 TTGTACAAAAATAATTTGGAAGG + Intergenic
1090996394 11:131869579-131869601 TTTTAGAAATAGCAGTTGGAAGG - Intronic
1091107305 11:132934684-132934706 TTCCAGAAGTAGAAGTTGAAAGG - Intronic
1091916263 12:4273406-4273428 TTGAAGAAGCCAAAGTTGGAGGG + Intergenic
1092625858 12:10327626-10327648 TTGTAAAAGAAGAAGTACAATGG - Intergenic
1093586314 12:20841295-20841317 TTGCAGAAAAGAAAGTTGGAGGG - Intronic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1097778311 12:63673561-63673583 TTGCTGAAGAAGAATTTGAAAGG - Intergenic
1098477057 12:70917438-70917460 CTGTAAAATAAGCAGTTGGATGG + Intronic
1098588073 12:72178959-72178981 ATATAGAAGAACAATTTGGAAGG + Intronic
1099066101 12:77981692-77981714 TTATAGAAGAAAAAATTGGGAGG + Intronic
1100337481 12:93645253-93645275 TTGGAGAAGACCAAGTTGGGTGG + Intergenic
1100648600 12:96559440-96559462 TTGTTAAATAAAAAGTTGGAGGG - Intronic
1101560798 12:105855826-105855848 TGGAAGAACAGGAAGTTGGAAGG + Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1106598319 13:31165831-31165853 TGGAGGAAGAAGAAGATGGAGGG - Intergenic
1107734632 13:43385741-43385763 TTGTAGAAAAAGAAATTGGAAGG + Intronic
1107993508 13:45838952-45838974 TTGAAAAAGAAAATGTTGGAAGG + Intronic
1108087297 13:46806824-46806846 TTTTAGAAGATGGAGTAGGAGGG + Intergenic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1108592304 13:51922833-51922855 TGATAGAGGAAGAGGTTGGAGGG - Intergenic
1109632243 13:65065427-65065449 CTGTAGATGAACAAGTTGGGTGG - Intergenic
1110041388 13:70763847-70763869 TTATAGAAGATGAGGTAGGAAGG + Intergenic
1110065197 13:71095673-71095695 TTGTAGAGGAAGAGGATAGATGG + Intergenic
1110139147 13:72105737-72105759 TTGGAGATGAATAAATTGGAAGG - Intergenic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1111257292 13:85687053-85687075 TTCTAGAAGAAGAAAATGCATGG + Intergenic
1112126267 13:96471753-96471775 TTTAAGAAGCAGAGGTTGGAGGG + Intronic
1112332460 13:98486866-98486888 TTGTGGATGAAGAATTTAGAGGG - Intronic
1112662937 13:101534355-101534377 TTTTAGAAGAAGAAATAGGTAGG + Intronic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1115100847 14:29697067-29697089 TTCTAGAAAAAGAAGCTGGTTGG + Intronic
1115630946 14:35244790-35244812 TTGGGGAAGAAGAAGTTAGCAGG - Intronic
1116509643 14:45727959-45727981 TTTTAAAAGAAGATGCTGGATGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117367528 14:55044265-55044287 TCATAGAAGAAGGAATTGGAAGG - Exonic
1118150883 14:63189318-63189340 TTGTTGAAATAGAAGATGGAAGG - Intergenic
1118359912 14:65047114-65047136 TTGTAGTAGAAAAAGTAAGAAGG - Intronic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118899131 14:69972223-69972245 TTGCAGAAAAAGAAGTTACATGG - Intronic
1120374351 14:83681893-83681915 TTGTAACAGAAGAAGATAGATGG + Intergenic
1122368584 14:101214333-101214355 TTAAAGAAAAAGAAGTTGAATGG + Intergenic
1123964611 15:25442483-25442505 TAGTTGAAGAGGAATTTGGAAGG - Intergenic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124781687 15:32642159-32642181 TTGCAGAAAAAGAAATTGGAGGG + Intronic
1125469529 15:39989403-39989425 TGGTAGAAGCAGAATTTGCAAGG + Intronic
1128310466 15:66628766-66628788 ATGGAAAAGAAGAAGTTGCAAGG + Intronic
1128760455 15:70213105-70213127 ATGTAAAAGAAGAGGTGGGAGGG + Intergenic
1129150811 15:73686739-73686761 TTGTAGAACAAGTGGCTGGATGG + Intronic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130549876 15:84883549-84883571 ATGCAGAAGAAAAAGTTGTATGG + Intergenic
1130555659 15:84920824-84920846 GTGTGGAAGAAGAAGATGAATGG + Intronic
1130958245 15:88642223-88642245 TTGAAAAAGAGGAAGTTGGCTGG - Intronic
1131202757 15:90414156-90414178 TTCTAGAAAAAGAAGTTGGCTGG + Intronic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1137519178 16:49177518-49177540 TTGAAGAAGAAGTGGTTAGAAGG + Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138273297 16:55711750-55711772 TAGTGGAACAAGAAGCTGGAAGG - Intergenic
1138565991 16:57833275-57833297 TTGTATAAGATGTAGTTGCAGGG + Intronic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139105578 16:63823139-63823161 TTGTTCAAGAAGAATTTGGTGGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142906401 17:3045315-3045337 ATGTAGACTAAGAAGTGGGAGGG - Intergenic
1144746672 17:17620575-17620597 TTCAAGAAGAAGAAATTGGCTGG + Intergenic
1145042619 17:19588091-19588113 TTGTAGAAGGTGAAGTTGTGGGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1148187096 17:45652241-45652263 TTCTAGAATAAGAAGTTGCCAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150020439 17:61607116-61607138 TTGCAGAAAAAGAGGTGGGAGGG + Intergenic
1150963814 17:69944749-69944771 TTCTAGAAGAAGAAACAGGAAGG + Intergenic
1150979835 17:70128658-70128680 CTGTAGAATATGAAGTTCGAAGG - Intronic
1151150324 17:72079595-72079617 TGGGAGAAGAAGTACTTGGAGGG + Intergenic
1151996094 17:77609997-77610019 TAGGAGCAAAAGAAGTTGGAAGG + Intergenic
1153043571 18:836063-836085 TTGTAGAAGTAGAAGATGGGAGG + Intergenic
1153632772 18:7088032-7088054 TTTTAGAAGAAGAAGTGGGTTGG + Intronic
1153757334 18:8297705-8297727 TTGTAGAAAAAGAAACTGGGGGG + Intronic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1155836632 18:30593784-30593806 TTGTAAATGCAGAAGTTGGCTGG - Intergenic
1156209566 18:34924771-34924793 TTGTTGAAGAACAGTTTGGATGG - Intergenic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157267338 18:46237779-46237801 TGTTGGAAGATGAAGTTGGAAGG + Intronic
1157303543 18:46498814-46498836 TTGGTGAAGAAGAATTTGGTGGG + Intronic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158686571 18:59620327-59620349 TTGGAGGAGAAGAATTTGGTTGG + Intronic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1159482781 18:69012151-69012173 TGGTGGAAGAGTAAGTTGGAAGG + Intronic
1159544106 18:69818039-69818061 TTGTAGGAGAAGGAGGTGTATGG - Intronic
1161819701 19:6522317-6522339 TTGCACAGGAAGTAGTTGGAAGG - Intergenic
1162194749 19:8975870-8975892 TTGTAGGAGATGAGGTTAGAGGG + Exonic
1162394575 19:10409376-10409398 ATGAAGAAGACGATGTTGGAGGG - Intronic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1168301170 19:55406015-55406037 TTGTAGAGGAAGCTGGTGGAAGG - Intronic
925080982 2:1066253-1066275 TGGTTGAAGAAGTAGTTGGTTGG + Intronic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925842985 2:8009660-8009682 TTGTGGAATCAGATGTTGGATGG + Intergenic
926277677 2:11417034-11417056 TTGTAGGAGAAGATGTGGGATGG + Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928574638 2:32642561-32642583 TTTTAAAAGAAGAGGTTAGAAGG + Intronic
929098213 2:38284158-38284180 ATGTAGAAAATGAAGTTGGAAGG - Intergenic
929749624 2:44696409-44696431 TTCTAAAAGAAGGAGTTGAAGGG + Intronic
929805825 2:45144159-45144181 TTGTAGAGGTAGAAGTTAAATGG + Intergenic
929904336 2:46033059-46033081 ATGTAGAAGCATGAGTTGGATGG + Intronic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
932693250 2:73931508-73931530 TGGCAGAACAAGAGGTTGGAAGG + Intronic
933117095 2:78487712-78487734 TTGCAGAAGAACATGTGGGATGG + Intergenic
935608038 2:104990389-104990411 TGGTAGGAGATGAGGTTGGAGGG + Intergenic
935640240 2:105283209-105283231 TTGTACAAGAAAAAGTTATATGG + Intronic
937802784 2:126099997-126100019 TTTTGGAAGAAGGAGTTGCATGG + Intergenic
938388473 2:130884912-130884934 TTATTGATGAAGAAGCTGGAGGG - Intronic
939629224 2:144514384-144514406 TCGTATAAGTAGAAGCTGGAAGG - Intronic
940647156 2:156403665-156403687 TTGTACCAGAAGGAGTTGGGTGG - Intergenic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
941465734 2:165824342-165824364 TTACAGAATAAGAAGATGGAAGG - Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942887915 2:180951117-180951139 TTCTAGAAGAAGAGAATGGAGGG - Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
945274804 2:207977466-207977488 CTGTAGAAGTATAAGTTGTAAGG + Exonic
945935985 2:215903160-215903182 TTGGAGAAGAAGAGGGTGAAGGG - Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
947080067 2:226386146-226386168 TTATAGAACAAGAAGTTTGGGGG - Intergenic
947298756 2:228664595-228664617 TTGTGGATCAAGAATTTGGAGGG - Intergenic
948022467 2:234747060-234747082 TTGAAGAAGTAGTAGTTGGTTGG - Intergenic
948149679 2:235735151-235735173 TTGTAGACGATGGCGTTGGAAGG + Intronic
948242855 2:236452830-236452852 TTTTAAAAAAGGAAGTTGGATGG - Intronic
1169031580 20:2413076-2413098 ATCTTGAAAAAGAAGTTGGAGGG + Intronic
1169895886 20:10504523-10504545 TTGTTGTAGAGGAAGTAGGAGGG + Intronic
1170604118 20:17863247-17863269 TTGTATAAGAGCAAGTGGGATGG - Intergenic
1172540012 20:35705312-35705334 ACAGAGAAGAAGAAGTTGGATGG - Exonic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1174332742 20:49832650-49832672 TTGCAGAAGACGAGGTGGGAGGG + Intronic
1176985857 21:15434641-15434663 TTGTATTAAAGGAAGTTGGAAGG - Intergenic
1178272833 21:31208908-31208930 TTATCCTAGAAGAAGTTGGATGG - Intronic
1178973279 21:37200133-37200155 TTGTGGCAGAAGATGTTTGAAGG + Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179278961 21:39917467-39917489 TGGTAGAGGGAGAAGCTGGAAGG + Intronic
1179441676 21:41399233-41399255 TAGAAGGAGAAGAAGTTGTAAGG + Exonic
1181319577 22:21994222-21994244 TGGGAGAAGAAGTAGCTGGAGGG + Intergenic
1181722545 22:24786786-24786808 TTGTAGGAGAAAAAGTTTGCAGG - Intergenic
1181868936 22:25882678-25882700 TTGGGGAAGATGAAGTGGGAAGG - Intronic
1182051993 22:27320002-27320024 TTCCAGAAGAAGAAATTGGTTGG + Intergenic
1182168875 22:28206285-28206307 TTTTATAAGAAGAAATTTGAGGG - Intronic
1182769829 22:32786660-32786682 TTGTTTAAGAATAAGTTGCAGGG - Intronic
1182833511 22:33322824-33322846 TTGTAGAAAAAAAAGGTGGCCGG + Intronic
1182874801 22:33682390-33682412 GTGCAGGAGAAGAAGTGGGAAGG - Intronic
1183392317 22:37552526-37552548 CTGGAGAGCAAGAAGTTGGAGGG - Intergenic
1184256353 22:43289244-43289266 TTGTATAAGAAGCAGATTGATGG - Intronic
949411826 3:3773911-3773933 TTGGGGAAGAAGAAGTGGGGAGG - Intronic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
954919482 3:54177343-54177365 TTTTACAAGAAGAATTTGGCAGG + Intronic
955199993 3:56842982-56843004 TTGTATAACTAGAAGTTTGAGGG - Intronic
955487115 3:59446464-59446486 TTGTAGCAGAAAAATTGGGAAGG - Intergenic
956548057 3:70428301-70428323 TTGAAGAAGAAAGAGTTAGAAGG + Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957584734 3:82119145-82119167 TTTTAGTGTAAGAAGTTGGATGG + Intergenic
957885265 3:86279948-86279970 TAGTAGAAGAAGAGGTCTGACGG - Intergenic
958530333 3:95321599-95321621 TTTCAGAAGAAGAAATTGAAGGG - Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960438016 3:117651189-117651211 GTGTAGGAGAAGGAGTTGGCAGG - Intergenic
962882092 3:139587882-139587904 TTATAGAAGAAAATGGTGGAAGG + Intronic
963148534 3:142019650-142019672 TTGTATAAGAAGATGTTGGGGGG - Intronic
964097534 3:152950298-152950320 GGGCAGAAGATGAAGTTGGATGG - Intergenic
964348417 3:155778541-155778563 TTTTAGGAGAAAAAGTTGGGAGG + Intronic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965940752 3:174178131-174178153 ATTTAGAAGAATAAGTGGGAAGG + Intronic
966942176 3:184754232-184754254 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942190 3:184754287-184754309 TGGTGGAAGAAGAAGGTGGTGGG + Intergenic
966942231 3:184754448-184754470 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942271 3:184754606-184754628 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942285 3:184754667-184754689 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942292 3:184754696-184754718 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942326 3:184754834-184754856 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
967274541 3:187761006-187761028 TGGTGGAAGATAAAGTTGGAGGG + Intergenic
967326804 3:188249054-188249076 TTTTAGAAGAAGAAATTTTATGG + Intronic
967612235 3:191521000-191521022 TTCTAGAAGAAGAAAATGGAAGG + Intergenic
969159235 4:5240984-5241006 TTGAAGAAGAACAGGATGGAAGG - Intronic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972136280 4:35898585-35898607 TTCTACAAGAAGAAATTTGAAGG - Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
976469172 4:85407367-85407389 TTGTAGCAGAAGAATTGGGTGGG - Intergenic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
977595001 4:98868923-98868945 AAGAAGAAGAAGAAGTTGGGTGG + Intergenic
977689961 4:99894781-99894803 TTGTAGATGAAGAAATTTGAGGG + Intergenic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979438090 4:120718901-120718923 TTGCAGAAGAGAAAGTTTGAGGG - Intronic
979499865 4:121427629-121427651 TAGTAGAAGATGAGCTTGGAGGG - Intergenic
979714155 4:123817052-123817074 TTTTACAAGAAGAACTTGTAAGG + Intergenic
981773145 4:148333553-148333575 TTGGAGAATGAAAAGTTGGAAGG + Intronic
982515492 4:156343068-156343090 CTGTACCACAAGAAGTTGGAGGG - Intergenic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984448238 4:179865899-179865921 TTCTAGAGGAAGAAATTAGAAGG - Intergenic
984676699 4:182557040-182557062 TTGTAGAAGAAGAAAATGTCTGG - Intronic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985126888 4:186703305-186703327 TTGTAGAAGTAGAAATTCTATGG - Intronic
985648020 5:1094120-1094142 TTTTAGAAGAAGAAGGTGCCAGG - Intronic
986020169 5:3794496-3794518 TTAAAGAAAAAGAAGTTGAATGG + Intergenic
986074603 5:4322577-4322599 TCTTAGAGGAAGAAGTTGGAAGG - Intergenic
986835949 5:11637458-11637480 TTGCAGTAGAAGTAATTGGAGGG - Intronic
986960334 5:13202889-13202911 GTGTCCAAGAAGAAGTTTGATGG - Intergenic
988372221 5:30385849-30385871 TTGGAAAAGAACAAGTTTGAAGG + Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990407436 5:55505110-55505132 TTCTAGAGAAAGAATTTGGAAGG + Intronic
990996009 5:61732807-61732829 ATTTAGGAGAAGAAGTTGGCTGG + Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993092220 5:83440555-83440577 TTTTAGATGAAGATTTTGGATGG + Intergenic
994243437 5:97450617-97450639 GTGAAAAAGAAGAAGTGGGAAGG - Intergenic
994771430 5:103986607-103986629 TTGTAAAAGAACAAATTGAACGG + Intergenic
995751667 5:115458708-115458730 TGCTAGTAGAAGAAGTTGCATGG + Intergenic
995787758 5:115848737-115848759 TTATACAACAAGAAGTTGGAAGG - Intronic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996447140 5:123568009-123568031 TTGAAGAAGTAGTAGTTGGTTGG + Intronic
996798402 5:127376022-127376044 CTGTAGAAGAAGTAGATTGAGGG + Intronic
996801918 5:127413676-127413698 TTGTAGAAGCAGCAGTTTGGAGG - Intronic
996882668 5:128317703-128317725 TTGGAGCAGAAGAAGTTGGAAGG - Intronic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998164654 5:139836181-139836203 TTGCAGGGGAAGAAGTTAGAGGG - Intronic
999567851 5:152885776-152885798 CAGTAGAAGATAAAGTTGGAGGG - Intergenic
999882323 5:155879588-155879610 TTGTATAAGATGCAGTTTGAAGG + Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000971593 5:167720911-167720933 ATGCAGAAGACGAAGTTGGGTGG + Intronic
1001122112 5:168989337-168989359 TTGTAGAAGAATCACTTGGGTGG - Intronic
1003438109 6:6112505-6112527 TTATAAAAGAAAAAGTTGGAGGG - Intergenic
1004893924 6:20128159-20128181 GTGTTGGAGAAGAAGTGGGAGGG - Intronic
1005216891 6:23539965-23539987 TTTCAGAAGACGAAATTGGAAGG - Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1010704786 6:79094977-79094999 TTGTAGAAGAACATGTGGGATGG - Intergenic
1013001468 6:106027059-106027081 TTGTGGAAGAATAAGGTGGGTGG - Intergenic
1013653525 6:112221502-112221524 TTGAAGAAGACTAATTTGGATGG - Intronic
1014244944 6:119058102-119058124 TTGTAGAAGAGCATGTGGGATGG - Intronic
1015606998 6:134968154-134968176 TTATTGGAAAAGAAGTTGGAAGG + Intronic
1015836531 6:137426240-137426262 TTGTAGAAGATGAGAATGGAAGG + Intergenic
1016312501 6:142749234-142749256 GGGTAGAAGAGGAAGTTTGAGGG - Intergenic
1016927598 6:149367471-149367493 GGGTAGAAGATGAAGTTAGAGGG + Intronic
1017674205 6:156796949-156796971 TGGTAGAAGAGGCATTTGGAGGG + Intronic
1019212316 6:170416654-170416676 TTGTAGAAGAAGAAGTCACAAGG - Intergenic
1020745449 7:12073364-12073386 TTAGAGAAGAAGAACTTTGAGGG - Intergenic
1021242760 7:18224722-18224744 TTGTAGAATTCGAAGTTGAATGG + Intronic
1021499484 7:21314983-21315005 TTTTATAAGAAGACGTTGGCTGG - Intergenic
1021807637 7:24373109-24373131 TTGTAGAAGAGCATGTGGGATGG - Intergenic
1022002261 7:26237166-26237188 TTGTAGAGGCATATGTTGGAGGG - Intergenic
1022701658 7:32766650-32766672 TTGCTGAAGAAGAATTTGAAAGG - Intergenic
1022937243 7:35191231-35191253 TTGCTGAAGAAGAATTTGAAAGG - Intergenic
1022995748 7:35753720-35753742 AGGTAGAAGAAAAAGTTGGTCGG - Intergenic
1023139248 7:37084630-37084652 TTGTAAATGAAGATGTTGCAGGG + Intronic
1023305318 7:38819730-38819752 TCTAAGAAGAAGCAGTTGGAGGG - Intronic
1024133487 7:46382261-46382283 TTGCAAAAGAAAAAGTTGAAGGG + Intergenic
1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG + Intergenic
1025028627 7:55537811-55537833 TTGAAGTAGTGGAAGTTGGAGGG - Intronic
1026606573 7:71821353-71821375 ATGAAGAAGAAGAAGTTTAAAGG + Intronic
1027740480 7:81996833-81996855 GTGTTGAAAAAAAAGTTGGAAGG - Intronic
1028372881 7:90114371-90114393 TTGCTGAAGAAGAATTTGAAAGG + Intergenic
1028812090 7:95099115-95099137 TTGTAGTAAAAGAAGCAGGAAGG + Intronic
1029833405 7:103283873-103283895 TTGCTGAAGAAGAATTTGAAAGG - Intergenic
1029925681 7:104313933-104313955 TTGTAGATGATGAAGTGGGTGGG + Intergenic
1030483722 7:110138861-110138883 CTATAGAAGAAAAAGTTAGAAGG + Intergenic
1031110702 7:117605139-117605161 TTGGAAAAGAAGAAGTGGAATGG - Intronic
1033347357 7:140535884-140535906 TTGTAGATGTTAAAGTTGGAAGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033965088 7:146965574-146965596 GGGTACAAGCAGAAGTTGGATGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034698737 7:153078088-153078110 TTGTTGGATAAGAAGTTGAATGG + Intergenic
1034916081 7:155040411-155040433 TTGAAGAAAAAGAAGTTTGGAGG + Intergenic
1036021475 8:4851728-4851750 TTGAAGAAGAAGAAGTCTTAAGG - Intronic
1036036978 8:5030240-5030262 TTGTTCAAGAGGAAGCTGGAGGG + Intergenic
1037266564 8:17068815-17068837 AGGTAGAAGAAGATGTTGGTTGG + Intronic
1038545655 8:28424144-28424166 TTCTAGAAGAACATGTGGGATGG - Intronic
1039044792 8:33439992-33440014 TTGAAGAGGAAGCAGTTTGAAGG - Intronic
1041042492 8:53861731-53861753 TTGTTGAAGAACAAGTTTGCTGG + Intronic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041609904 8:59833479-59833501 ATGTAGAAGAAGGAGTAGGGAGG + Intergenic
1041939220 8:63368354-63368376 TAGTGGAACAACAAGTTGGAGGG + Intergenic
1042276514 8:67010421-67010443 CTCTAGAAGAAAAAGTTTGATGG + Intronic
1042735493 8:71983349-71983371 TGCTAGAGGAAGCAGTTGGATGG + Intronic
1043331475 8:79122678-79122700 TTGGGGAAGGAGTAGTTGGAGGG - Intergenic
1043636506 8:82390784-82390806 TTGTGGAAGAAGAAGAAGGCTGG + Intergenic
1044050005 8:87489381-87489403 ATGTAGAAGAAAAAATTGAAAGG + Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044631415 8:94282593-94282615 GTGTAGAACATGCAGTTGGAAGG - Intergenic
1046257367 8:111718973-111718995 TGGTAGAACAAAAAATTGGAAGG + Intergenic
1047886945 8:129261787-129261809 TGGTAGAAGCAGCAGTTGAAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1049270677 8:141694058-141694080 TAATAGAAGCAGAGGTTGGAGGG + Intergenic
1049986268 9:954574-954596 TTGGAGGAGGAGAAGTTGGTAGG + Intronic
1050040147 9:1482277-1482299 TTCTAGAAGAAAAAGTAGGTAGG - Intergenic
1050177336 9:2882039-2882061 TGGCAGAAGAAGAATTTGAATGG + Intergenic
1050626626 9:7511027-7511049 TTGGGGAGGAAGAAATTGGAGGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1055378037 9:75671795-75671817 TGGTTGAAGAAGAAGAGGGAAGG + Intergenic
1056084475 9:83132037-83132059 TTCTAGAAGAACATGTAGGATGG - Intergenic
1056922742 9:90806292-90806314 TTAGACAAGAAGAAGATGGAGGG - Intronic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1058354748 9:104071138-104071160 TTGTTGAAGATGGGGTTGGAGGG + Intergenic
1058977071 9:110135012-110135034 TGGTAGAAAAATAAGATGGATGG + Intronic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1060066413 9:120504957-120504979 TTATAGAAGAAAATGTTGGGTGG - Intronic
1187017860 X:15348362-15348384 GTGAAGAAGAATAGGTTGGAGGG - Intronic
1187279850 X:17849937-17849959 TTCTAGATGAAGAAAATGGAAGG - Intronic
1187455404 X:19437000-19437022 CTGTAGAAGAACAGGTTTGATGG - Intronic
1187808865 X:23153371-23153393 TCTTAGAAGAACAAGTGGGATGG + Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187830246 X:23374010-23374032 TGGGAGTAGAAGAAGTGGGAAGG + Intronic
1188230409 X:27656080-27656102 TTGTGGAAGAATATGTAGGAGGG + Intronic
1188539730 X:31236251-31236273 TTGTAGAACAAGAAGTCTGGAGG - Intronic
1188894025 X:35644150-35644172 TTGAAGAAAAGGAGGTTGGAAGG - Intergenic
1189384552 X:40526761-40526783 TTGTGGGAAAAGAAGCTGGATGG - Intergenic
1191033619 X:56002105-56002127 TGATAGAAGATGAAGTTGGAGGG - Intergenic
1192037994 X:67586669-67586691 TTTTAGAAGATGAGGTTAGACGG + Intronic
1192052775 X:67742312-67742334 TTTATGAAGAAGAAATTGGAGGG + Intergenic
1192549006 X:72038960-72038982 TTGTAGAAGCAGAAGTGGATTGG + Intergenic
1192588821 X:72342579-72342601 TTTTAGAACTAGAAGCTGGAGGG + Intronic
1193573626 X:83174548-83174570 TTGGAGAAGAGGTATTTGGATGG - Intergenic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1195336286 X:103858135-103858157 TTCTAGAAGAGGAAGATTGAGGG + Intergenic
1195942115 X:110175303-110175325 TTACAAAAGGAGAAGTTGGAAGG + Exonic
1196086303 X:111685939-111685961 TAATAGAAGATGAAGTTGGGTGG + Intronic
1197268095 X:124397511-124397533 TTTTTGCTGAAGAAGTTGGAAGG + Intronic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1199217422 X:145276790-145276812 TTGTAGAAGAAGAAATGCTAGGG - Intergenic
1199680027 X:150217863-150217885 ATGTAGAAGATAAAGTTGAAGGG + Intergenic
1201979236 Y:19890022-19890044 TTGTAGAAGAAGAAGTATTTTGG + Intergenic