ID: 965327629

View in Genome Browser
Species Human (GRCh38)
Location 3:167327596-167327618
Sequence GCTTCATTTTAAAACATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965327629 Original CRISPR GCTTCATTTTAAAACATTCA TGG Intronic
901485117 1:9554327-9554349 GTTTCTTTTAAAAATATTCACGG - Intronic
901573642 1:10182459-10182481 GCAGCATTTTATTACATTCACGG - Intergenic
903400839 1:23046334-23046356 CTTTTATTTTAAAACATTCTAGG + Intronic
903594739 1:24485388-24485410 GCAGCATTTGAAACCATTCAAGG + Intergenic
903988663 1:27248955-27248977 GTTTCTTTTTAAAAAATTTAAGG - Intronic
904362799 1:29988751-29988773 TCTTCATGTTAAAAAAATCAGGG + Intergenic
905083260 1:35344611-35344633 TCTTCATATTAACACATTAAAGG - Intronic
905113327 1:35614417-35614439 ATTTCATTTTAAAAGATTCTTGG - Intronic
906016213 1:42582572-42582594 GCTTTATTTTAAAAAATCCCTGG - Intronic
907063185 1:51451740-51451762 TCTTCATTTTAAAGCATTCAAGG + Intronic
908018775 1:59878024-59878046 GACTTATTTCAAAACATTCAAGG - Intergenic
908393393 1:63703515-63703537 ACTTGATTTTAATACATTCTGGG + Intergenic
908557422 1:65270429-65270451 AAATTATTTTAAAACATTCAGGG - Intronic
909756652 1:79234034-79234056 GCTGCATTCTAAAACATTGAAGG + Intergenic
909762380 1:79307420-79307442 GCTTTATTTTAACAGATTGATGG - Intergenic
910176176 1:84432867-84432889 CCTTCTTTTTAAAATGTTCATGG + Intergenic
911668745 1:100584889-100584911 GCTTCATTTTTGCACAGTCAGGG + Intergenic
911886427 1:103306011-103306033 GGTCCATTTTAAAACATTCTGGG - Intergenic
912085520 1:105997667-105997689 GCTTCATTTTAAAAGACGAAAGG - Intergenic
913500368 1:119467394-119467416 GCTACATTTTAAACCTTGCATGG + Intergenic
913511207 1:119564239-119564261 GCTCCATTTTAAACCCTGCATGG + Intergenic
913658478 1:120984249-120984271 GATTCATTACAAAACCTTCAAGG - Intergenic
914009845 1:143767358-143767380 GATTCATTACAAAACCTTCAAGG - Intergenic
914648465 1:149676019-149676041 GATTCATTACAAAACCTTCAAGG - Intergenic
915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG + Intronic
915878280 1:159636763-159636785 GCATCATTTTAAAACAGTAGTGG - Intergenic
916153018 1:161814495-161814517 TCTTCATTTTAAAAAATAGAAGG + Intronic
918422583 1:184379071-184379093 GCTTCATTTTAAACTCTTCCAGG + Intergenic
919095002 1:193022882-193022904 GCTCTATATTAAAACATTAAAGG + Intronic
919346675 1:196389565-196389587 GCTGGATTTTTAAACTTTCAAGG + Intronic
919830079 1:201534584-201534606 GACTCAGTTTAAAACATGCATGG + Intergenic
920298057 1:204971629-204971651 GCTTTACTTTCAAACATTTAAGG + Intronic
921566052 1:216721879-216721901 GCATCAGTTTGAAACACTCAAGG - Intronic
921784798 1:219217538-219217560 TCTTCATTCTAAATCATGCAAGG + Intergenic
922417648 1:225436187-225436209 GTTTCTTTTTAAAACCTACAGGG + Intergenic
922627865 1:227068941-227068963 GCTTCATTTTATTACATTTTGGG - Intronic
923814610 1:237362023-237362045 GCTACATTTTAACACATAGACGG - Intronic
924498380 1:244612394-244612416 CCTACATTTTAAAAAAATCAGGG + Intronic
924582012 1:245330871-245330893 ACTTCATTTGAAATCATTAAAGG - Intronic
1063029052 10:2213365-2213387 GCTTCCTTGCAAAACAATCATGG - Intergenic
1063396959 10:5697259-5697281 ACTGCATTTTAACAAATTCAGGG + Intronic
1063965896 10:11345474-11345496 GCTTCCTTTAAAAACGTTCATGG - Intergenic
1064598283 10:16968164-16968186 GTTTCCTTTTAAAACACTGATGG - Intronic
1064939486 10:20717021-20717043 GCTTCCTTTAAAAAGATGCATGG + Intergenic
1065312845 10:24432754-24432776 GCCTAATTTTCAAAAATTCAAGG - Intronic
1065633319 10:27704776-27704798 TCCTCATTTTAAAACTTTAAAGG - Intronic
1067202657 10:44186711-44186733 GTTTCCCTTTAAAACATGCATGG - Intergenic
1068078203 10:52284922-52284944 CCCTCAATTTAAAACATTCAGGG - Intronic
1068089036 10:52409986-52410008 GCTGAATTTTAAGAAATTCAAGG - Intergenic
1068634384 10:59332371-59332393 ATTTCATTTTAAAACATTTAAGG + Intronic
1068712330 10:60148445-60148467 GCTTCTTTTTAAAACCTGTATGG - Intronic
1070943143 10:80364802-80364824 GCTTCATTTTAGATCACTCTTGG - Intronic
1073079339 10:100848583-100848605 GCTTTTTTTTAAAAAAGTCAAGG + Intergenic
1073817943 10:107228144-107228166 GCTTCATTTTAAGAGACTCATGG + Intergenic
1074408153 10:113198927-113198949 GCTTCATTCTAAAACAATCTGGG + Intergenic
1077695336 11:4388181-4388203 ACTTCATTTAAGAACATTCCAGG + Intronic
1079052588 11:17175462-17175484 GTTTTATTTTAAAAAATTAATGG - Intronic
1079413089 11:20208177-20208199 GCTCTAATTTCAAACATTCAGGG + Intergenic
1080233988 11:30047566-30047588 GCTTTATTTTAAAAAATTGAGGG - Intergenic
1080922471 11:36722720-36722742 GCTTCAATATATGACATTCAGGG + Intergenic
1082840039 11:57681776-57681798 GCTTCATTTTTAGACATCAAAGG + Intronic
1083249085 11:61453460-61453482 GCTGCCTTTTTAAAAATTCAAGG - Intronic
1084982350 11:72836663-72836685 GCTTCTTATAAAAACATTCCTGG - Intronic
1085166759 11:74408240-74408262 CCTTAATTTTAAAACTGTCACGG - Intergenic
1085907298 11:80779145-80779167 GATTCATTTTACAACATGCCAGG + Intergenic
1087071992 11:94090363-94090385 GCTATATTTTTATACATTCATGG - Intronic
1087262671 11:96028185-96028207 TCTTATTTTTAAAACTTTCAAGG - Intronic
1087658530 11:100956836-100956858 ACTTATTTTTAAAATATTCATGG - Intronic
1087872200 11:103309854-103309876 GTTACACATTAAAACATTCAAGG - Intronic
1088613982 11:111604175-111604197 TCTTCATTTTAAAAAATGCTGGG - Intronic
1089568690 11:119387788-119387810 GCTTCATTTTAATCCATTGGTGG + Intergenic
1090845414 11:130525989-130526011 GCCTCAAGTTAAAACACTCAGGG + Intergenic
1091109012 11:132948132-132948154 CCTTGATTTTAAAACATGCCCGG - Intronic
1092796863 12:12120326-12120348 GCTTCAGCTTAAAAAAATCATGG + Exonic
1093265299 12:16996598-16996620 GCTGCAGTTTAAAACATGAAAGG - Intergenic
1094069915 12:26401852-26401874 GTTTCCTTTTAAAACATGCTGGG + Intronic
1094349049 12:29502962-29502984 TTTTCATTGTAAAACATTCCAGG - Intronic
1094354709 12:29565512-29565534 GTTACCTTTTAAAACATTCCAGG + Intronic
1095357987 12:41299123-41299145 TCTTCATTTTACAACATTCTAGG + Intronic
1097214501 12:57399783-57399805 GCTTACTTTAAAAACTTTCAGGG - Intronic
1097759600 12:63447500-63447522 GCTAAATTTTAAGACATTCGGGG + Intergenic
1098059039 12:66540474-66540496 CCTTTATTTTATAACAATCATGG - Intronic
1099026507 12:77470783-77470805 TCTCCCTTTTAAAACATTCCAGG - Intergenic
1100621445 12:96278939-96278961 AATTCACTGTAAAACATTCAGGG - Exonic
1100718701 12:97332583-97332605 GCTACATTTTGAAGCATTAAGGG + Intergenic
1100892633 12:99142835-99142857 GCTTCCTTTTGAAACAGTGAGGG + Intronic
1101228185 12:102710886-102710908 TCTTCATGTTATAACCTTCATGG - Intergenic
1101869841 12:108556793-108556815 TCTTCATTAAAGAACATTCAAGG + Intronic
1105886311 13:24645240-24645262 ACTTAATTTTAAAACATTTGGGG + Intergenic
1106507031 13:30379996-30380018 ACTTCATTAAAAAACATGCATGG + Intergenic
1106913578 13:34488252-34488274 ACTTTATTTTAAAAGGTTCATGG + Intergenic
1108889530 13:55236598-55236620 ATTTCATTTTAAAACTGTCAGGG - Intergenic
1109608034 13:64723960-64723982 TCTCCATTTCAAAACATTCCAGG + Intergenic
1109812578 13:67533891-67533913 GTTTCATTTTAATAGATTTAGGG - Intergenic
1110727397 13:78840951-78840973 GCTTCTTTTCAAAATCTTCAAGG - Intergenic
1111223346 13:85236281-85236303 GCTACAATTCAAAACATTGACGG + Intergenic
1111858831 13:93674995-93675017 TCTTCATTTTAAAACAGAAATGG - Intronic
1112718114 13:102210497-102210519 GCTTCATTTAAAAATGTGCAAGG + Intronic
1113130618 13:107033074-107033096 TCTTTATATTAAGACATTCATGG + Intergenic
1113680841 13:112243824-112243846 CCGTTATTTTAAAACATTCATGG - Intergenic
1113979816 13:114265066-114265088 GATTCATTTCAAAATATTCCAGG - Intronic
1114737063 14:25052466-25052488 GCTTCTTGTTTAAACATCCACGG - Intergenic
1114952529 14:27773821-27773843 GCTTGATTTTAAAATATTTGTGG + Intergenic
1116059709 14:39907196-39907218 GATTTTTTTTAAAACATTGAAGG - Intergenic
1116987370 14:51235908-51235930 CTTTCATCTTAAAACAATCAGGG + Intergenic
1117404017 14:55384160-55384182 GCTTCTTTTTAAAAAATTAATGG + Intronic
1117437831 14:55734051-55734073 TCTTCATTATACAAAATTCAGGG - Intergenic
1117897056 14:60498112-60498134 GCTTCATTACAATAAATTCATGG - Intronic
1119899487 14:78247800-78247822 GTTTATTTTTAAAACATTCTTGG + Intronic
1120361327 14:83506336-83506358 GATTCATTTTAGAACTTTCTTGG - Intergenic
1120416690 14:84228024-84228046 GCTTCATCATAAAAATTTCAGGG + Intergenic
1120464894 14:84843717-84843739 ACTTCATTTAAAAGGATTCAAGG + Intergenic
1121504801 14:94468858-94468880 GTTTCTTTCTAAAACTTTCAAGG + Intronic
1122657572 14:103272743-103272765 GCTTCAGTTTAAAAAATACAAGG + Intergenic
1124430106 15:29599811-29599833 GCTTCCTTTAAAAACTTTAATGG + Intergenic
1125438860 15:39679265-39679287 GCTAGATTTTAAGATATTCAGGG - Intronic
1126421094 15:48472878-48472900 TATTCATTTTATATCATTCAGGG - Intronic
1127850468 15:62907600-62907622 GCTTCATCTTAAAACGAGCAAGG + Intergenic
1128052492 15:64676133-64676155 GCTTCACTTTAAGGCCTTCAGGG - Exonic
1131180758 15:90237997-90238019 GCTTCACTTTTAAACATTTTTGG + Intronic
1131180892 15:90239144-90239166 GCTTCATTTTCATACATAGATGG - Intronic
1131615746 15:94015483-94015505 GCTTCATTTCACAACATGAATGG + Intergenic
1134027243 16:10963810-10963832 GCATCATCTAAAAACATTCTTGG + Intronic
1134365083 16:13569720-13569742 TCTACATTTAAAAACAATCATGG - Intergenic
1134652019 16:15917110-15917132 CCTACATTTTAAAACATTAAAGG + Intergenic
1135160911 16:20095449-20095471 ACTTCATTCTTAAACATCCATGG - Intergenic
1136985621 16:35101542-35101564 CCTTTATTTTAAAAGATACAGGG - Intergenic
1137243019 16:46674681-46674703 CCTTTATTTTAAAAGATACAGGG + Intronic
1137315350 16:47314251-47314273 GCTACATTTTTAAAAATTGATGG - Intronic
1137481818 16:48858315-48858337 CCTTTATTTTTACACATTCATGG + Intergenic
1138747498 16:59380657-59380679 GTTTCATTTGAGAACATCCATGG + Intergenic
1140286201 16:73605228-73605250 TCTTTATTTCAAAACACTCACGG + Intergenic
1141081373 16:81056022-81056044 GTTTCATTTTAAAAGATACATGG + Intronic
1141384884 16:83611959-83611981 ACATTATTTTAAAGCATTCATGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144022314 17:11248182-11248204 GCTTAATTTTAAAACAATTCAGG + Intronic
1144478185 17:15607394-15607416 GCTTCATTTTGCACCATTCTTGG - Intronic
1144560004 17:16313431-16313453 GCTGCATTTGAAAAGTTTCAGGG + Intronic
1144920109 17:18756312-18756334 GCTTCATTTTGCACCATTCTTGG + Intronic
1144939693 17:18929901-18929923 ACTTCATGTTTAAACTTTCAAGG + Intronic
1145355972 17:22152211-22152233 TCTTTATTTTATAACTTTCAGGG - Intergenic
1146340165 17:32011930-32011952 GTTTAATTTTCAAACATTTAGGG + Intronic
1148176159 17:45567148-45567170 GTTTAATTTTCAAACATTTAGGG - Intergenic
1148295214 17:46495818-46495840 GTTTAATTTTCAAACATTTAGGG + Intergenic
1148395332 17:47303749-47303771 GCTTCCCTTTAACACCTTCATGG + Intronic
1149744970 17:59087716-59087738 GCTTTATTTCTAAACATTCAGGG + Intronic
1150407390 17:64914121-64914143 GTTTAATTTTCAAACATTTAGGG - Intronic
1153748571 18:8206546-8206568 GTTGCTTATTAAAACATTCAGGG - Intronic
1155089923 18:22497408-22497430 ACTTACTTTTAAAAAATTCAGGG - Intergenic
1155626612 18:27842515-27842537 GCTTAATAGTAAAACATTAATGG + Intergenic
1155725438 18:29075751-29075773 GCTGGATTTAAATACATTCAGGG + Intergenic
1155801276 18:30106855-30106877 GCTCCATTTTAACAAATTTATGG - Intergenic
1156985709 18:43349033-43349055 GTTTCATTATAAAAAATTAATGG + Intergenic
1158072233 18:53486565-53486587 CCTGCAGTTTAAAACATTCCAGG - Intronic
1158191590 18:54834758-54834780 ATTTCATTTTAAAACGTTTAGGG + Intronic
1158457065 18:57617613-57617635 GGATCTTTTGAAAACATTCAAGG + Intronic
1159219948 18:65447704-65447726 TATTCATTTTAAAACATGAAAGG - Intergenic
1159267303 18:66099131-66099153 GTCTCATTTTAATACTTTCATGG - Intergenic
1159341827 18:67144384-67144406 GCAACATTTTACAACATTAATGG - Intergenic
1159524716 18:69573249-69573271 GCTTCATTTTCACACATTGGAGG - Intronic
1160962304 19:1728232-1728254 GCTAAATATTAAAACATTTACGG - Intergenic
1161059167 19:2206284-2206306 GCTTCTTTAAAAAACATTCTCGG - Intronic
1162519653 19:11172275-11172297 GCTTCATTTTCAAAAAATTAAGG - Intronic
1162863287 19:13524608-13524630 CCTACATTTTAAAACAATAAAGG - Intronic
1166018782 19:40005624-40005646 GTTTCATTTGAAAACATTCTGGG + Intronic
926433990 2:12819431-12819453 GCTTAATTTGAAAATAGTCAAGG + Intergenic
926549690 2:14286835-14286857 GCTGCATCTCAAAATATTCACGG + Intergenic
926944512 2:18172256-18172278 GCTACATTTTAAAAAAGTGATGG + Intronic
928122894 2:28596431-28596453 TCTTCATTTTAAAACAAGTATGG - Intronic
928840846 2:35602882-35602904 GTTTTATTTTAAAAAATTTATGG + Intergenic
928938273 2:36702844-36702866 GATTTATTTCAAAACATCCAGGG - Intronic
929366528 2:41164470-41164492 GATTAATTTTAAAAAATGCATGG + Intergenic
930204260 2:48572484-48572506 GTTTGCTTTTAAAAAATTCAGGG + Intronic
931367704 2:61633550-61633572 CCTTCCTTATAAAACATTTATGG - Intergenic
931436515 2:62252156-62252178 TTTTTATTTTCAAACATTCAAGG + Intergenic
931490922 2:62746088-62746110 ACCTCATTTGAAAACATTGATGG - Intronic
932497331 2:72152860-72152882 GCATCAATTGAAAAAATTCAAGG - Intergenic
933007146 2:77009588-77009610 GCTTTATTTTGAATCATACATGG - Intronic
934165358 2:89289259-89289281 TCTTCATTCTAAGACAGTCAAGG - Intergenic
934201916 2:89893203-89893225 TCTTCATTCTAAGACAGTCAAGG + Intergenic
934484729 2:94695139-94695161 GCTTGATTTTAAAATATTTGTGG - Intergenic
934790653 2:97057163-97057185 TCTTCATTCTAAGATATTCAAGG + Intergenic
934815805 2:97325366-97325388 TCTTCATTCTAAGATATTCAAGG - Intergenic
934821890 2:97383117-97383139 TCTTCATTCTAAGATATTCAAGG + Intergenic
935035221 2:99364772-99364794 GATTCACTTTAAAACATGCTAGG - Intronic
935284743 2:101554495-101554517 TGCTGATTTTAAAACATTCAAGG + Intergenic
935704641 2:105845269-105845291 GCCTGATTTTGAAACATGCAAGG - Intronic
936077492 2:109411008-109411030 GCTTAATTTTAAATGATTCTAGG - Intronic
936251482 2:110871435-110871457 GCTTCATTGTACAAGCTTCAGGG - Intronic
936468909 2:112780411-112780433 GTTACATTTTAAAACCTTCTAGG + Intronic
937213185 2:120291425-120291447 GGCTCATTTTAAAAAAATCAGGG + Intronic
938508363 2:131911415-131911437 GCTTCTAATTAAAACAGTCAGGG + Intergenic
939513296 2:143134454-143134476 TCTTCTTTTTAAAAGATTAAAGG + Intronic
939625903 2:144476945-144476967 TGATCATTTAAAAACATTCATGG + Intronic
940509983 2:154601816-154601838 TCTTCATTTCAAAATATTCATGG + Intergenic
941329242 2:164158135-164158157 GCTTAATTTTAAAATATTTGTGG + Intergenic
941475370 2:165945378-165945400 GCTTTATTTTAACCCATTTATGG - Intronic
941544467 2:166831371-166831393 ACTTGATTCTAAAACATACACGG - Intergenic
942351155 2:175054895-175054917 CCTTCATTTTTAACCATTCCTGG + Intergenic
942779612 2:179625966-179625988 ACTTTATTTTAAAAATTTCAAGG + Intronic
944699136 2:202230602-202230624 GTTTCTTTTTAAAAGAGTCATGG - Intronic
945045495 2:205777834-205777856 GCTGCCCCTTAAAACATTCATGG + Intronic
945279356 2:208021147-208021169 TCTTCATTAAAAAACATCCAAGG - Intronic
945315517 2:208367055-208367077 GCCTGATTTTGAATCATTCATGG + Intronic
945565552 2:211394076-211394098 ATTTCCTTTTAAAATATTCATGG + Intronic
945640121 2:212415033-212415055 GTTTCAGTTTAATAGATTCAAGG - Intronic
946845547 2:223855780-223855802 TCTTCTATTTAAAACAATCAGGG + Intronic
946979496 2:225193357-225193379 GTTTGATTTTACAAAATTCATGG + Intergenic
1169051497 20:2582383-2582405 GCTTCATTTTAAAACATCCATGG - Intronic
1169580299 20:7015303-7015325 GCTCCTTTTTCAAACAATCATGG - Intergenic
1170788777 20:19490823-19490845 GCATATTTTTAAAACCTTCAAGG - Intronic
1171980709 20:31626563-31626585 GCTTCATTTCCAAATATTTAGGG - Intergenic
1173456019 20:43201936-43201958 ATTTCATTTTAAAACATTAACGG - Intergenic
1173701968 20:45080303-45080325 TCTTCATTTTTAAAGTTTCAAGG - Intergenic
1174853678 20:54022025-54022047 GCTGCATTTTTACACATTAAAGG - Intronic
1175045765 20:56103637-56103659 GTATCATTTTCAAGCATTCAAGG - Intergenic
1175725229 20:61313389-61313411 CCTTCATTTTAAAAGATGAAGGG - Intronic
1176785129 21:13247148-13247170 GCTTCTAATTAAAACAGTCAGGG - Intergenic
1176948208 21:15010358-15010380 CCTTCATTTGAAACCTTTCATGG + Intronic
1177947286 21:27487034-27487056 GATTTTTTCTAAAACATTCAAGG + Intergenic
1177983167 21:27940906-27940928 GCTTCTAATTAAAACAGTCAGGG - Intergenic
1178956420 21:37026395-37026417 GGTTCATTTTAAAACACTTTGGG - Intergenic
1179343449 21:40533809-40533831 GCTTCATTTTCAAACCTAGATGG - Intronic
1180164214 21:46012635-46012657 CCTACATTTTAGAACATTCTGGG - Intergenic
1181771139 22:25126508-25126530 GGCTCATTTAAAAACATTTATGG - Intronic
1181974471 22:26719141-26719163 GCTTCATTTCAGAACATTCTTGG - Intergenic
1183913579 22:41098215-41098237 GTTTCATTTTGAAATTTTCATGG + Intronic
1184637485 22:45845641-45845663 GCTTCACTTTAAAAGATAGAGGG + Intergenic
1184871387 22:47240764-47240786 GTTTTCTTTTAAAAGATTCATGG + Intergenic
950115017 3:10445109-10445131 GTTTCTTTTAAAAACATGCATGG - Intronic
950768336 3:15290829-15290851 TCTTCCATTTAAAACTTTCATGG - Intronic
951013087 3:17703647-17703669 TCTTAATCTTAAAACATTCAGGG - Intronic
951287275 3:20828642-20828664 GGAACATTTTAAGACATTCAGGG - Intergenic
951721881 3:25708540-25708562 GCTGAATTTCAAAAAATTCATGG - Intergenic
954937928 3:54344009-54344031 TATGCATTTTAAAAAATTCAGGG + Intronic
955527454 3:59836055-59836077 GCTGCATTTAGTAACATTCATGG - Intronic
955724293 3:61916437-61916459 CATTTATTTTAAAACATACAAGG - Intronic
955759718 3:62266153-62266175 ATTTTATTTTTAAACATTCAGGG + Intronic
956769760 3:72515160-72515182 ATTTTATTTTAAAACATTCAAGG - Intergenic
956934721 3:74087530-74087552 GTTTCATTGCAAAACATTCCTGG - Intergenic
958461194 3:94398433-94398455 ACTACATATTAAAACAATCATGG + Intergenic
959604595 3:108228294-108228316 ACTTCATGTCAAAACATTCCAGG + Intergenic
959743266 3:109746424-109746446 GCTGTATTCTAAAACCTTCAGGG - Intergenic
959929452 3:111963013-111963035 GCTTCCTTTTAACAAATACAAGG - Intronic
962069155 3:132014875-132014897 GATCCATTTTAAAATATTCTTGG - Intronic
962124553 3:132602224-132602246 GATTCTTTTCAAAACATTCCTGG + Intronic
962295480 3:134180409-134180431 GCTTCATGTTTTAACATCCATGG - Intronic
963634638 3:147779061-147779083 GCCTCCTTTTAAAACACTTAAGG + Intergenic
964547569 3:157851069-157851091 TGTTCATTTTCAAACATTCTTGG - Intergenic
965187249 3:165481340-165481362 GCCTCATTTTATAACAGCCAGGG - Intergenic
965327629 3:167327596-167327618 GCTTCATTTTAAAACATTCATGG + Intronic
965515244 3:169614548-169614570 GATTCCTTTTTAAACATTTATGG + Intronic
965894338 3:173555888-173555910 GTTGAATTTTCAAACATTCAAGG - Intronic
966354892 3:179069362-179069384 GGTTCATTTTGAGACACTCAGGG - Intronic
967438066 3:189474314-189474336 TCTTCATTATATAAAATTCAAGG + Intergenic
967586300 3:191218200-191218222 GCTAAATTTTAAAGCATTCCAGG + Intronic
968790483 4:2657467-2657489 GCTTATTTCTAACACATTCAGGG + Intronic
970541347 4:17082973-17082995 GAGTCATTTTAAAACTTTGATGG + Intergenic
971100168 4:23457765-23457787 GCTTCTTTGTAAAACATCAAAGG - Intergenic
971653447 4:29309759-29309781 GCTACATTTTAAAGTTTTCAAGG + Intergenic
973533567 4:51857815-51857837 GCTTAAATTCAATACATTCAGGG - Intronic
974521202 4:62982458-62982480 TCTACTTTTTAAAACTTTCATGG + Intergenic
974633029 4:64519745-64519767 GCTCCATTTTAAAATAATCCTGG + Intergenic
974737019 4:65948852-65948874 GCTTCTTTGCAAAACATGCATGG - Intergenic
974894003 4:67916522-67916544 TCATCAATTAAAAACATTCATGG + Intronic
976555994 4:86452235-86452257 GCTGCATCTTAAATCATTCCTGG - Intronic
976797103 4:88946481-88946503 GCTTTAATTTAACACATTCCTGG + Intronic
977085160 4:92587189-92587211 GTTTTATTTTATAACCTTCATGG - Intronic
977230601 4:94448028-94448050 GCTTCATTTTATCATAATCAGGG - Intergenic
977475876 4:97508465-97508487 GCTTAATTTCAAAACATTTGAGG - Intronic
978597228 4:110391344-110391366 GCTTCCCTTAAAAACATGCATGG + Intronic
979185089 4:117778988-117779010 ACATAATTTTAAAACATACATGG - Intergenic
979499365 4:121421935-121421957 TCTTCATCATCAAACATTCAAGG + Intergenic
980403076 4:132319074-132319096 AATTTATTTTAACACATTCATGG + Intergenic
981111942 4:140944972-140944994 CCTTGATTTTAAAACCTACATGG + Intronic
981599937 4:146475807-146475829 TCTTAATTTTAAAAGCTTCAAGG - Intronic
981933637 4:150216267-150216289 GCATCATTTAAAGGCATTCATGG - Intronic
982736704 4:159014146-159014168 GCTGCATATTAAAACATGAATGG - Intronic
982882635 4:160739425-160739447 GCTTCATTTTTAATAAATCAAGG - Intergenic
983136328 4:164086685-164086707 ACTTCATTTTAAGAAATTAATGG + Intronic
983510374 4:168603065-168603087 GCATAGTTTTAATACATTCAGGG - Intronic
983614527 4:169687208-169687230 GATTCAATTTAAAACAATCTAGG + Intronic
983766855 4:171494743-171494765 GCTACATTCTGAATCATTCAAGG - Intergenic
983813716 4:172096736-172096758 TCTTTATTTTAAAACATGAATGG - Intronic
984187431 4:176562980-176563002 GCTTCATTTTAAAACGTGGTAGG + Intergenic
984366747 4:178808564-178808586 GCTTGTTTTTTAACCATTCACGG + Intergenic
986755396 5:10831477-10831499 TCATCATATTTAAACATTCATGG + Intergenic
987459808 5:18194921-18194943 GTTACATTTAAAAACATGCAAGG - Intergenic
987544710 5:19298635-19298657 ACTTTATTCTAAAATATTCAAGG - Intergenic
988724350 5:33911028-33911050 GCTTAATTTCAAAACATTTGAGG + Intergenic
988819069 5:34862825-34862847 GCTTCAGTCAAAAACATTCCTGG - Intronic
988836895 5:35042220-35042242 GCTTGAATTTTAAACAGTCAAGG + Intronic
988954290 5:36298780-36298802 GCTTGCTTTCAAAACATTCTAGG + Intronic
989350724 5:40483189-40483211 GCTTTATTTTAAACACTTCATGG - Intergenic
990484364 5:56243290-56243312 GATTGATTTTGAAACATTAAAGG + Intergenic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
990926194 5:61026863-61026885 ACATGATTTTAAAATATTCATGG + Intronic
991521115 5:67497170-67497192 CATTCATTTTTAAACTTTCATGG - Intergenic
992041048 5:72833097-72833119 GGTTTATTTTAAGTCATTCATGG - Intronic
992339394 5:75807071-75807093 GCTTCCTTTAAAAACAGTCAGGG - Intergenic
992978817 5:82144590-82144612 GTTTTATTTTAAAATATTTAGGG + Intronic
993983973 5:94574806-94574828 GCTTGAGTTTAAAAAGTTCAAGG - Intronic
994985625 5:106929692-106929714 GTTTAATTATAAAACAGTCAGGG + Intergenic
995639280 5:114235285-114235307 GTTTCATTATAAAACATTTGAGG + Intergenic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
995972187 5:117985856-117985878 ACATCGTTATAAAACATTCAGGG + Intergenic
996350130 5:122531023-122531045 GCTACACTTTAAAATATTCGTGG + Intergenic
996795760 5:127345025-127345047 GTTTCATATTAATACATTGAGGG + Intronic
998758022 5:145402120-145402142 GCTTTATTTTAACACATGGATGG + Intergenic
999487897 5:152018000-152018022 TCATCATTTTAAAACATTTTTGG + Intergenic
1000212818 5:159123699-159123721 GCTTCTTTTTAAAAAAATTATGG + Intergenic
1000602032 5:163286602-163286624 GCTTCATTTAAAAGCATTTCAGG - Intergenic
1000700742 5:164446005-164446027 GAATCATTTAAATACATTCAAGG + Intergenic
1000936733 5:167310791-167310813 GATTCATTTTCACACATTCCAGG - Intronic
1003307129 6:4939736-4939758 GCTTCATTATTATCCATTCAGGG + Intronic
1003796219 6:9608147-9608169 CCATCATTTTAAAAAATTAAGGG + Intronic
1005053260 6:21705423-21705445 ACTGAATTTTAAAACATGCAGGG - Intergenic
1005195418 6:23277427-23277449 CCTTCATATTAAAAGATTAAAGG + Intergenic
1007603293 6:43097210-43097232 GCTTCCCTTTAAAAGATGCAGGG - Intronic
1008403218 6:51088683-51088705 TATTAATTTTCAAACATTCAGGG + Intergenic
1008552312 6:52644732-52644754 GCTTCATTTCAGACCATGCATGG - Intergenic
1008916019 6:56787699-56787721 ACTTTGTTTTAAAACAATCATGG + Intronic
1009349357 6:62654205-62654227 GTTTCAATTTAAAAAATTGAGGG + Intergenic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1009559665 6:65222646-65222668 GCATCCTTGTAAAACTTTCATGG - Intronic
1009637761 6:66287288-66287310 GCTTAATTTTCAAATATTTAAGG + Intergenic
1009684053 6:66933840-66933862 GTTTCTTCTTACAACATTCAAGG + Intergenic
1010430077 6:75768685-75768707 AATTCATTTTAATACCTTCAAGG + Intronic
1011596636 6:89023012-89023034 ACTAGATTTTAAAAGATTCATGG - Intergenic
1013893353 6:115053751-115053773 GCTTCAGTTTAAAAGACTCCAGG - Intergenic
1014007565 6:116437443-116437465 GATTCATTTTAACAAATTAAGGG + Exonic
1015058320 6:128930859-128930881 ACTTCCTTTTAAAACACCCACGG + Intronic
1015236315 6:130975298-130975320 AGTTAATTTTAAAATATTCAAGG + Intronic
1015719580 6:136227472-136227494 GCTTGCTTTTAAAAAATTGATGG - Intergenic
1016644548 6:146390999-146391021 TATTGATTTTAAAACAATCAGGG + Intronic
1017736095 6:157366037-157366059 GATTTATTTTAAAATAATCATGG - Intergenic
1018177824 6:161193339-161193361 GATTCATTTTAAAACCTCCTAGG + Intronic
1018326888 6:162679833-162679855 TCTTCATTTTTAAAGTTTCATGG - Intronic
1019107351 6:169679195-169679217 GCTTCATTTTATATATTTCAGGG - Intronic
1020187961 7:5973305-5973327 GGTTCATTTTAAAACAAAAAAGG + Exonic
1020294957 7:6751464-6751486 GTTTCATTTTAAAACAAAAAAGG - Intergenic
1021047266 7:15939044-15939066 GCTTCATTTTAGAGCTTTCATGG + Intergenic
1021506700 7:21393644-21393666 TATTAATTTTAAAACATTTAAGG + Intergenic
1021694645 7:23264800-23264822 GTTTTATTTTAAAATATGCAGGG + Intronic
1022287682 7:28970028-28970050 GCTCCATTTTAGAAAATTAAAGG - Intergenic
1022401695 7:30044480-30044502 GAGTTATCTTAAAACATTCAAGG - Intronic
1022835513 7:34110028-34110050 ACTTCATTTGAAAACTTTCTAGG - Intronic
1023664428 7:42507301-42507323 GATGCATTTTAAAAAACTCAAGG - Intergenic
1024919250 7:54540868-54540890 ACTTTATGTTCAAACATTCATGG - Intergenic
1028845105 7:95471454-95471476 TCTTCATTTTAAAATATACCTGG - Intergenic
1029038562 7:97549292-97549314 TCATTATTTTAAAACATCCATGG - Intergenic
1030565018 7:111142758-111142780 GCTCCATTTTAAGCCATTGAGGG - Intronic
1030639657 7:111989730-111989752 CCTTACTTTTAAAACAATCATGG + Intronic
1031292552 7:119955253-119955275 GTTTAATTTTAAAAAATACAAGG + Intergenic
1031306961 7:120140478-120140500 ACTCCATATTCAAACATTCAAGG + Intergenic
1031645362 7:124219350-124219372 ACTGCATTTTAAAAAATCCACGG + Intergenic
1031967766 7:128040092-128040114 CCTTAATTTAAAAACACTCAGGG + Intronic
1032856279 7:135836283-135836305 ACCTCCTTTTAAAACAGTCAAGG - Intergenic
1032864901 7:135915480-135915502 GCTTCCTTTCTAAACCTTCAGGG - Intergenic
1034407946 7:150918057-150918079 ACTTAAGTTTAAAAAATTCATGG - Intergenic
1034484702 7:151351992-151352014 ACACCATTTTAAAACATACAAGG - Intronic
1035117426 7:156536335-156536357 GCATCATTTGAAAAGATACAGGG - Intergenic
1035861689 8:3035627-3035649 CCAAAATTTTAAAACATTCAAGG - Intronic
1037178924 8:15980512-15980534 GGTTCCTTTTTAAACATCCAAGG - Intergenic
1037457858 8:19082048-19082070 GCTACATTCTAAAACATGAAAGG + Intronic
1037670176 8:21008220-21008242 GCTTCATTTTATACATTTCAGGG - Intergenic
1038773443 8:30505499-30505521 CATTTATTTTAGAACATTCAGGG - Intronic
1038931312 8:32196864-32196886 GTCTCATTCTAAAACACTCAAGG - Intronic
1039815603 8:41091976-41091998 GCTACACTTTACAACATTCTTGG - Intergenic
1041824356 8:62076164-62076186 GCTTCTTTTTAAAACTTTTAAGG + Intergenic
1042772611 8:72395882-72395904 GCAACATTTTAAAATTTTCAAGG + Intergenic
1043166324 8:76907434-76907456 GCTTGAGTTTCAAACTTTCATGG - Intergenic
1044569692 8:93702704-93702726 GTTTCATTTTAAAACATGTTAGG - Intronic
1045533939 8:103009585-103009607 GCTTCATTTAAGAAGAGTCAGGG + Intergenic
1045613899 8:103883614-103883636 TCTTAATTATAAAACATTTAAGG + Intronic
1046242781 8:111519159-111519181 ACTGCATTTTTAAAGATTCATGG - Intergenic
1046270228 8:111886211-111886233 GCCTCATTGAAAAAGATTCAGGG - Intergenic
1049170315 8:141156388-141156410 CTTTCATTTCAAAATATTCATGG - Intronic
1051798732 9:20906919-20906941 GCTTCAATTTACAAAATTCTAGG + Intronic
1052560614 9:30078886-30078908 TCCTCATTTTAATACATTCATGG - Intergenic
1052719722 9:32159661-32159683 CCTTCATTATTAAACATTCTTGG + Intergenic
1052723830 9:32205099-32205121 GTTTCTTTTTAAAATATTTATGG - Intergenic
1053141989 9:35688332-35688354 GGTTCATCTTAAAACAATCCTGG + Intronic
1053571371 9:39311836-39311858 GTTTCATTTTATAACATTTTTGG - Intergenic
1053596851 9:39571630-39571652 GTTTCATTTTAGAATATCCATGG - Intergenic
1053673066 9:40389233-40389255 GCTTGATTTTAAAATATTTGTGG + Intergenic
1053854823 9:42328278-42328300 GTTTCATTTTAGAATATCCATGG - Intergenic
1054092933 9:60870534-60870556 GTTTCATTTTATAACATTTTTGG - Intergenic
1054114409 9:61146446-61146468 GTTTCATTTTATAACATTTTTGG - Intergenic
1054125774 9:61307176-61307198 GTTTCATTTTATAACATTTTTGG + Intergenic
1054384172 9:64529299-64529321 GCTTGATTTTAAAATATTTGTGG + Intergenic
1054511559 9:65987050-65987072 GCTTGATTTTAAAATATTTGTGG - Intergenic
1054569402 9:66793369-66793391 GTTTCATTTTAGAATATCCATGG + Intergenic
1054593345 9:67036076-67036098 GTTTCATTTTATAACATTTTTGG + Intergenic
1054721888 9:68612077-68612099 GATTCATTTTAACAAATTAAGGG + Intergenic
1055066704 9:72126199-72126221 CCTTTATTTAAAAACATTCCTGG - Intronic
1186490186 X:9965764-9965786 GCTTCATTTTAACATATACTAGG + Intergenic
1188528919 X:31115885-31115907 GTTTCATTTTAAAACTTCCTAGG - Intronic
1188610759 X:32094426-32094448 TCTTCATTTACAAATATTCATGG + Intronic
1189585540 X:42457778-42457800 AATTCATTATATAACATTCATGG + Intergenic
1192032956 X:67534190-67534212 TCATCATTTTTCAACATTCATGG - Intergenic
1192108883 X:68343982-68344004 GCTTCATTTTAATACATCCTAGG + Intronic
1192838359 X:74826790-74826812 CCTTTAGTTTAAAACATGCATGG - Intronic
1193101346 X:77616959-77616981 GCTTCAATTTAAAACCTACCTGG - Intronic
1194738993 X:97549960-97549982 CCTTTATTTTAAAACATACTTGG - Intronic
1195369860 X:104162870-104162892 GCATCATTTTACAACAATCCAGG - Intergenic
1196098054 X:111820741-111820763 TCCTCATTTTAAAATATTCCGGG + Intronic
1196772113 X:119304622-119304644 GATTAATTTTTAAACATTTAGGG + Intergenic
1197050725 X:122055959-122055981 GTTTCATTTCAAAATAATCAAGG - Intergenic
1197234459 X:124043643-124043665 CCTTCCTTTTACAACATTCCAGG - Intronic
1198059031 X:133025210-133025232 TCTTCATTTTAATATAGTCAGGG - Exonic
1198479404 X:137027346-137027368 ACATCCTTTAAAAACATTCAGGG + Intergenic
1198716585 X:139564011-139564033 GTTTCTTGTTAAATCATTCATGG + Intergenic
1198931270 X:141863642-141863664 TATTCATTTTAAAATATGCAAGG + Intronic
1199768655 X:150959203-150959225 GTTAGATTTTAAAACATTTAAGG - Intergenic