ID: 965327881

View in Genome Browser
Species Human (GRCh38)
Location 3:167330487-167330509
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1735
Summary {0: 2, 1: 38, 2: 151, 3: 453, 4: 1091}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965327881_965327890 10 Left 965327881 3:167330487-167330509 CCTAACCCCCAATGTGACTACAT 0: 2
1: 38
2: 151
3: 453
4: 1091
Right 965327890 3:167330520-167330542 GGCCTATAAGGAGGTAATTGAGG 0: 1
1: 5
2: 67
3: 291
4: 786
965327881_965327889 1 Left 965327881 3:167330487-167330509 CCTAACCCCCAATGTGACTACAT 0: 2
1: 38
2: 151
3: 453
4: 1091
Right 965327889 3:167330511-167330533 TTGAGATAGGGCCTATAAGGAGG 0: 3
1: 6
2: 63
3: 281
4: 930
965327881_965327888 -2 Left 965327881 3:167330487-167330509 CCTAACCCCCAATGTGACTACAT 0: 2
1: 38
2: 151
3: 453
4: 1091
Right 965327888 3:167330508-167330530 ATTTTGAGATAGGGCCTATAAGG 0: 1
1: 11
2: 91
3: 365
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965327881 Original CRISPR ATGTAGTCACATTGGGGGTT AGG (reversed) Intronic
900330649 1:2132938-2132960 ATACAGCCACATTGGGGGTTAGG + Intronic
900426542 1:2582784-2582806 ATGTCATCACATTAGGGATTCGG - Intergenic
900434223 1:2620546-2620568 AAATAGTCACATTAGGGGTTAGG - Intronic
900674910 1:3879420-3879442 ATGCAGTCACACTGGGGATTAGG - Intronic
900822383 1:4899545-4899567 ATACAGTCACATTTGGGGTTTGG + Intergenic
900839597 1:5037530-5037552 ATACAGTCATATTGGAGGTTAGG - Intergenic
901233769 1:7656496-7656518 ATACAGTCACATTGGTGGTTAGG + Intronic
902079271 1:13810089-13810111 ATACAATCACATTGGGGGTTAGG + Intronic
902087467 1:13874458-13874480 ACACAGTCACATTGGGGGTTAGG + Intergenic
902355993 1:15900879-15900901 TTGTTGTCACAGTGGGGGTGGGG - Intronic
902416257 1:16241501-16241523 ATATGGTCACATTGGGGGCTAGG + Intergenic
902637893 1:17747013-17747035 ATGTAGTCACATTGGGGATTAGG + Intergenic
902701096 1:18172698-18172720 ATGCAGTCACATTGGGGGTTAGG + Intronic
903442571 1:23399475-23399497 ATACAGTCACAATGGGGTTTGGG + Intronic
903702563 1:25261202-25261224 ATATAGTCACTTTAGGGGTTAGG + Intronic
903711802 1:25331368-25331390 ATATAGTCACTTTAGGGGTTAGG + Intronic
904051528 1:27642405-27642427 GTATAGTCACATTAGGGGTTAGG + Intergenic
904352304 1:29916477-29916499 ATACAGTCACACTGGGGGTTAGG + Intergenic
904434672 1:30486620-30486642 ATACAGTAACACTGGGGGTTAGG - Intergenic
904816128 1:33200805-33200827 ATATAGTCACATTGGAGGTTAGG - Intergenic
904820296 1:33238650-33238672 ATCCAGTCACATTGGGGGTTAGG - Intergenic
904885182 1:33732352-33732374 ATGCAGTCACATTGGTGGCTAGG - Intronic
904954302 1:34270110-34270132 ATACTGTCACATTGGGGGTTAGG + Intergenic
905336877 1:37250793-37250815 GTACTGTCACATTGGGGGTTAGG - Intergenic
905407675 1:37746499-37746521 ATATAGTCACATTGGGGTTTAGG + Intronic
905545423 1:38794493-38794515 ATATCATCACACTGGGGGTTAGG + Intergenic
905749179 1:40447236-40447258 ATACAGTCACTTTAGGGGTTAGG - Intergenic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
905935775 1:41822978-41823000 ATAAAGTCACATTGAGAGTTAGG - Intronic
906222080 1:44088671-44088693 ATGCAGTCACATTGGGGGTTAGG + Intergenic
906677669 1:47704946-47704968 ATACCATCACATTGGGGGTTAGG + Intergenic
906717046 1:47978079-47978101 ATACCGTCACATTGGGGATTAGG - Intronic
906819893 1:48918487-48918509 ATGCCATCACATTGGAGGTTAGG - Intronic
907049030 1:51317344-51317366 ATGTCCTCACATTGGGAGTGGGG - Intronic
907093559 1:51752877-51752899 ATATAGCCACCTTTGGGGTTAGG + Intronic
907477037 1:54712763-54712785 ATATAATGACCTTGGGGGTTCGG - Intronic
907537879 1:55181817-55181839 ATATAGTCACATTGAGAGTTAGG - Intronic
907646696 1:56251725-56251747 ATACCATCACATTGGGGGTTAGG - Intergenic
907706043 1:56833701-56833723 ATATCATCACATCGGGGGTTAGG - Intergenic
907783876 1:57592945-57592967 ATGTAGTCACACTGAGGGTTGGG + Intronic
908081202 1:60580331-60580353 ATACAGTCACATTGGAAGTTTGG + Intergenic
908208450 1:61874589-61874611 ATATCTTCACCTTGGGGGTTAGG + Intronic
908255778 1:62302528-62302550 ATACCATCACATTGGGGGTTAGG - Intronic
908283932 1:62572753-62572775 ATGCCATCACATTGAGGGTTAGG + Intronic
908289325 1:62646422-62646444 TTACAGTCACATTGGGGGTTAGG - Intronic
908340945 1:63178542-63178564 AATTAGCCACATTGGAGGTTGGG - Intergenic
908366551 1:63429748-63429770 TAACAGTCACATTGGGGGTTAGG + Intronic
908484099 1:64573134-64573156 ATACCATCACATTGGGGGTTAGG - Intronic
908499019 1:64724252-64724274 ATGTAGTCACAGTGGGGATGTGG - Intergenic
908502398 1:64757310-64757332 ATATAGTAACACTGGGGGTTGGG - Intronic
908693088 1:66804498-66804520 ATTTCATCACCTTGGGGGTTAGG + Intergenic
908814532 1:68018215-68018237 ATGCCATCACATTGGGGATTCGG - Intergenic
908873126 1:68637492-68637514 ATACCATCACATTGGGGGTTAGG + Intergenic
908915723 1:69123450-69123472 ATACAGTCACATTGGCAGTTAGG - Intergenic
908964431 1:69740833-69740855 ATACAGTCACAGTGGGAGTTAGG + Intronic
909089936 1:71212817-71212839 ATATAGTTACATTGGTTGTTAGG + Intergenic
909216032 1:72890953-72890975 ATACAGTCACACTGGGGATTAGG - Intergenic
909303911 1:74047821-74047843 ATAAAGCCACACTGGGGGTTGGG - Intronic
909337539 1:74493086-74493108 ATTTAGTCACATGGGAGGCTAGG + Intronic
909359706 1:74746020-74746042 ATATAGTCACATTGGAGGTTAGG + Intronic
909465570 1:75970230-75970252 ATACAGTCACATTGAGGGTTAGG + Intergenic
909608522 1:77530822-77530844 ATTAAGTCAGAATGGGGGTTAGG - Intronic
909714359 1:78690202-78690224 ATATAGTCACATGGGACGTTAGG - Intergenic
909845805 1:80393482-80393504 ATATAGTCACATTGGGGGTTGGG - Intergenic
909870054 1:80728069-80728091 ATACAGTCACATTAGGGGTTAGG + Intergenic
910010088 1:82451080-82451102 ATACAATCACATTGGGGGTTAGG + Intergenic
910059992 1:83079177-83079199 ATACAGTCACACTGGGGGCTAGG - Intergenic
910101836 1:83585577-83585599 ATGCAGTCACACTGGGGTTAGGG - Intergenic
910551187 1:88477397-88477419 AAACAATCACATTGGGGGTTAGG - Intergenic
910568821 1:88677469-88677491 ATATTATCACATTGGAGGTTAGG + Intergenic
910737232 1:90473174-90473196 ATATAGTCACATTGCAGGTCAGG + Intergenic
911355186 1:96808533-96808555 GTACAGTTACATTGGGGGTTAGG + Intronic
911393022 1:97269813-97269835 ATACAGTCACATTGGAGGTTAGG + Intronic
911461950 1:98202550-98202572 ATGCCATCACATTGGAGGTTAGG - Intergenic
911826590 1:102493974-102493996 ATATAGTCACATTAGGGGTTAGG + Intergenic
911979286 1:104545832-104545854 ATACAGTCACATTGGGGGTTAGG - Intergenic
912089997 1:106060460-106060482 ATACAATCACATTGAGGGTTTGG - Intergenic
912204279 1:107493253-107493275 ATCCAGTCCCATTGGGGGTTAGG - Intergenic
913092423 1:115486611-115486633 GTATAGTCACATTAGGTGTTAGG + Intergenic
913168204 1:116208858-116208880 ATACTGTCACATTGGGGGTCAGG + Intergenic
913272579 1:117108821-117108843 ATATAGTCGCATTGGGTGTTAGG - Intergenic
913339055 1:117738974-117738996 ATACAGTCACATTGGGGATTAGG + Intergenic
914222913 1:145696401-145696423 GTATAGTCACATTGGGGATTAGG - Intronic
915275021 1:154782579-154782601 AGGCAGTTACATTGGAGGTTAGG + Intronic
915295072 1:154914645-154914667 AAGTAGTCACCTTGGGCATTTGG - Intergenic
915674499 1:157517833-157517855 ATGCCATCACATTGGGGATTAGG - Intronic
915812110 1:158924155-158924177 ATATCATCACACTGGGGGTTAGG - Intergenic
915814235 1:158949919-158949941 ATGTAGCCACAATTGGGTTTGGG + Intronic
915826423 1:159082737-159082759 ATATCATCACATTAGGGGTTAGG + Intronic
916149297 1:161770635-161770657 ATATAGTAATATTTGGGGTTAGG + Intronic
916194601 1:162211486-162211508 ATGCAGTCACATTGGGGTTTAGG + Intronic
916451467 1:164924415-164924437 ATATAGTCACACTGGGGCTTAGG + Intergenic
917018458 1:170560719-170560741 ATATAGTCACATTGGGGATTAGG - Intergenic
917287377 1:173435369-173435391 ATACAGCCACACTGGGGGTTAGG - Intergenic
917468415 1:175305263-175305285 GTACAGTCACATTGGGAGTTAGG - Intergenic
917991558 1:180385512-180385534 ATATAGTCATATTGAGTGTTAGG - Intronic
918025511 1:180741006-180741028 ATACCATCACATTGGGGGTTAGG + Intronic
918463699 1:184800844-184800866 ATGGGGCCACTTTGGGGGTTGGG + Intronic
918586491 1:186194276-186194298 ATGCAGTCACATTGAGGGTTAGG - Intergenic
918608185 1:186455342-186455364 ATACTGTCATATTGGGGGTTAGG + Intronic
918636361 1:186779454-186779476 ATACCATCACATTGGGGGTTAGG + Intergenic
918800583 1:188965200-188965222 ATACTGTCAGATTGGGGGTTGGG + Intergenic
919560521 1:199113329-199113351 ATACCATCACATTGGGGGTTAGG + Intergenic
920090067 1:203446358-203446380 ATACAGCCACATTGGGAGTTAGG - Intergenic
920161596 1:204002699-204002721 ATGCAGTCACACTGAAGGTTAGG - Intergenic
920396157 1:205647619-205647641 ATGCCATCACACTGGGGGTTAGG + Intergenic
920448110 1:206035462-206035484 ATGTAATCGATTTGGGGGTTTGG - Intergenic
921149533 1:212388464-212388486 ATATACTCACATTGAGGGTTAGG - Intronic
921260179 1:213379301-213379323 ATGAGGTCACATTGGAGGGTAGG + Intergenic
921306302 1:213800113-213800135 ATACCGTCACATAGGGGGTTAGG + Intergenic
921441904 1:215197592-215197614 ATGCAGTCACACTGGGGCTTAGG + Intronic
921483331 1:215688803-215688825 ATACAGTCACCTTGGGGGTTAGG + Intronic
921642560 1:217572604-217572626 ATGTATTCACTTTGGGGCCTTGG - Intronic
921661372 1:217806828-217806850 ATATAGTCACATTGAGAGTTAGG + Intronic
921941182 1:220841603-220841625 ATATGATCACATTGTGGGTTAGG - Intergenic
922369744 1:224897321-224897343 ATATCATCACATTGGGGGGTAGG + Intronic
922439876 1:225646238-225646260 ATAGAGTCACATTGAGGGTTAGG - Intronic
922926551 1:229351638-229351660 ATATAGTCACATCGGAGGTCAGG + Intergenic
923181411 1:231523434-231523456 ATATAGTCACACTAAGGGTTGGG + Intergenic
923968247 1:239168386-239168408 ATACAGTCACATTGAGGGTTGGG + Intergenic
924013463 1:239693281-239693303 ATACAGTTGCATTGGGGGTTGGG - Intronic
924418367 1:243883254-243883276 ATACAGTCACTTTGGGTGTTAGG + Intergenic
1062878865 10:962401-962423 ATGCAGTCACATGGGGGGTTAGG + Intergenic
1062895257 10:1098135-1098157 ATACAGCCACACTGGGGGTTAGG - Intronic
1063056443 10:2509838-2509860 ATACAGCCACATTGGGAGTTAGG + Intergenic
1063208510 10:3857360-3857382 ATACAGTCACATTTGGGGTTAGG - Intergenic
1063228571 10:4041026-4041048 AAGTAGTTACATAGGGGATTAGG + Intergenic
1063347957 10:5328643-5328665 ATACGGTCACATTGGAGGTTAGG - Intergenic
1063387938 10:5628104-5628126 ATATAATCACATTGGAAGTTAGG + Intergenic
1063388199 10:5630267-5630289 ATACAGTCACATTGAGGGGTAGG - Intergenic
1063566056 10:7172882-7172904 ATACACTCACTTTGGGGGTTTGG - Intronic
1064174974 10:13066909-13066931 ATGTAGACACATTGAAGGGTGGG - Intronic
1064347863 10:14548889-14548911 ATACTGTCACTTTGGGGGTTAGG - Intronic
1064354763 10:14606541-14606563 ATACAGTCACATTGGAGGTTAGG - Intronic
1064392228 10:14951834-14951856 ATACAGTCGCTTTGGGGGTTAGG + Intronic
1064513886 10:16125080-16125102 ATACAGTCAAATTAGGGGTTGGG + Intergenic
1064854058 10:19745506-19745528 ATGCTATCACATTGGGGGTTAGG - Intronic
1064878219 10:20019497-20019519 ATACAGTCACACTGGGGGCTAGG - Intronic
1064959991 10:20953148-20953170 ATACAGTCACATTGGTGGTTAGG - Intronic
1065052477 10:21810093-21810115 ATACAGTCACATTGGGAGTTAGG + Intronic
1065204278 10:23343200-23343222 ATATCGTCATCTTGGGGGTTAGG - Intronic
1065500388 10:26375847-26375869 ATATAGTCATACTAGGGGTTAGG - Intergenic
1065737399 10:28766481-28766503 ATAGCATCACATTGGGGGTTAGG + Intergenic
1065993797 10:31037449-31037471 ATCCAGTCACACTGGGAGTTAGG - Intergenic
1066117084 10:32249994-32250016 ATACAGTCACACTGGGGGTTGGG + Intergenic
1066262656 10:33744288-33744310 ATATAGTCACACTGCGTGTTAGG + Intergenic
1066693211 10:38053513-38053535 ATACAGTCACACTGGAGGTTGGG + Intronic
1066999583 10:42595545-42595567 ATACAGTCACACTGGAGGTTGGG - Intronic
1067803101 10:49373476-49373498 ATGCTGTCACCTTGGGGTTTAGG - Intronic
1067822384 10:49541267-49541289 AAATAGTCACATTGAGGGTTAGG + Intergenic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1067940657 10:50652517-50652539 ATGCAGTCACCTTGGGAATTAGG - Intergenic
1067963934 10:50887856-50887878 ATACCATCACATTGGGGGTTAGG + Intergenic
1068031272 10:51708351-51708373 ATACAGTCACATTGTGGGCTAGG + Intronic
1068061690 10:52075940-52075962 ATACTGTCACATTGGGGGTTAGG + Intronic
1068478227 10:57555675-57555697 ATTTAGTTACAATGGGGATTAGG - Intergenic
1068780842 10:60917689-60917711 ATACAATCACATTGGGGGTTAGG + Intronic
1068825778 10:61437258-61437280 ATATTGTCACATTTGGGGTTAGG + Intronic
1069576895 10:69537083-69537105 ATACAGTCACATTAGGGATTAGG + Intergenic
1069600203 10:69699970-69699992 ATACAGTCACACTGGAGGTTAGG + Intergenic
1070039322 10:72759695-72759717 AAATAGTCACATTGAGGGTTAGG - Intronic
1070084274 10:73220604-73220626 ATACAGTCACTTTGGGGGTTAGG - Intronic
1070339551 10:75484588-75484610 ATATAGTCACATTGGCAATTAGG - Intronic
1070590761 10:77799311-77799333 AGGTAGTCACACTGGGGCTTAGG - Intronic
1070643251 10:78184024-78184046 GTAAAGTCACATTAGGGGTTAGG - Intergenic
1070707722 10:78653465-78653487 ATACAGCCACACTGGGGGTTAGG - Intergenic
1070921145 10:80187202-80187224 ATGTCATCACACTGGGAGTTGGG - Intronic
1071159087 10:82725924-82725946 ATACAGTCTCATTGGGAGTTAGG - Intronic
1071185001 10:83032670-83032692 AAACAGTCACATTGGGGGTTAGG + Intergenic
1071260096 10:83911966-83911988 ATACAGTCACATTGGGGGTTAGG + Intergenic
1071300344 10:84251796-84251818 ATGCCATCACATTGGGGATTAGG + Intronic
1071302802 10:84269348-84269370 ATGTAGTCACATGGCAGGTGTGG + Intergenic
1071725846 10:88197653-88197675 ATATAGTCACATTGGGGGTTAGG - Intergenic
1071888614 10:89978141-89978163 ATATAGTCACACTGAGGGTTAGG - Intergenic
1071930378 10:90463142-90463164 GTATCATCACATTGGGGGTTAGG - Intergenic
1072087530 10:92095161-92095183 ATGAAGTGAGATCGGGGGTTGGG - Intronic
1072121504 10:92409106-92409128 ATACAGTCACATTAGGGGTTAGG + Intergenic
1072192905 10:93090596-93090618 ATACAGTCACATTGGGGATTAGG + Intergenic
1072215787 10:93286139-93286161 ATACTGTCACACTGGGGGTTAGG - Intergenic
1072508472 10:96093751-96093773 ATATAGCCACAGCGGGGGTTAGG + Intergenic
1072707588 10:97692420-97692442 GTGGAGTCACACTGGAGGTTAGG + Intergenic
1072758018 10:98033432-98033454 ATGCAGTCACACTAAGGGTTAGG - Intergenic
1072760312 10:98051238-98051260 CTCCAGTCACATTGGGGGTTAGG + Intergenic
1072810917 10:98461026-98461048 ATGTTATCACACTGGAGGTTGGG - Intronic
1073433579 10:103502582-103502604 ATATAGTCATATTGGGCATTAGG + Intronic
1073672967 10:105613005-105613027 ATATAGTCACATTGGGGGTCAGG + Intergenic
1073682582 10:105720014-105720036 ATATCATCACATTGGGGGTTAGG + Intergenic
1073703774 10:105959460-105959482 GTACAGTCACATTGGGGGTTGGG - Intergenic
1074321382 10:112406429-112406451 ATACTGTCACATTGGGGATTAGG + Intronic
1074671906 10:115800664-115800686 ATACCATCACATTGGGGGTTAGG - Intronic
1074672178 10:115804344-115804366 ATGCCATCACATTGAGGGTTAGG - Intronic
1074694689 10:116039201-116039223 TTGTAGTCCCATTGGTGGTAAGG + Intergenic
1074955848 10:118388493-118388515 ATGCCATCACATTGGGTGTTAGG - Intergenic
1074983290 10:118636537-118636559 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1074999516 10:118784819-118784841 ATACAGTCACACTGGGGATTAGG + Intergenic
1075005282 10:118825892-118825914 ATATAGTCACATTGGAGGTCAGG - Intergenic
1075077125 10:119359022-119359044 ATATAGTCACATTGGGGGTTAGG + Intronic
1075389249 10:122080633-122080655 ATACAGTCACATTGGGGATTAGG + Intronic
1075407833 10:122206366-122206388 AAATAATCACATTGGGGGTTGGG - Intronic
1075702767 10:124479768-124479790 ATGCAGTCACATTGGGGGTTAGG + Intronic
1075749520 10:124753951-124753973 ATATCATCACATTGGGGGTAGGG - Intronic
1075820254 10:125301934-125301956 ATACAGTCACGTTGTGGGTTAGG - Intergenic
1075832989 10:125427293-125427315 ATACAGTCACATTGGGGGTGGGG + Intergenic
1076089606 10:127670808-127670830 ATACAGCCACACTGGGGGTTAGG - Intergenic
1076381173 10:130025394-130025416 ATATAGTCACAATGGGGGTCAGG - Intergenic
1076557347 10:131335905-131335927 ATACCGTCGCATTGGGGGTTAGG - Intergenic
1076749588 10:132536105-132536127 ATACAGTCACATTGGAGGTTAGG + Intergenic
1076906046 10:133361644-133361666 ATGCAGTCACGGTAGGGGTTAGG + Intergenic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1077478359 11:2801638-2801660 ACACAGTCACATTGGGGATTAGG + Intronic
1078424095 11:11235322-11235344 ATATGATCACCTTGGGGGTTAGG - Intergenic
1078555882 11:12325764-12325786 ATATAGTCACACTGGGGGTTAGG + Intronic
1078919011 11:15809423-15809445 ATATCATCACCTTGGGGGTTAGG + Intergenic
1079119208 11:17668537-17668559 ATACAGTCACTTTGGGGATTAGG + Intergenic
1079142909 11:17824835-17824857 ATACAGTCACATTGGGGGTTAGG + Intronic
1079229612 11:18638410-18638432 ATATATTCACATTGGGGGTTAGG - Intergenic
1079430260 11:20382839-20382861 ATATAGACACCTTGGGGATTAGG + Intronic
1079506933 11:21163509-21163531 ATATAGTTACATTGGGGATTAGG - Intronic
1079747452 11:24150982-24151004 AAATAGTCACATTGGGGGTTAGG + Intergenic
1079915402 11:26363604-26363626 GTAGAGTCACATTGGGAGTTAGG + Intronic
1080000801 11:27346769-27346791 ATACAGTCACATTGAGGATTAGG - Intronic
1080196695 11:29618774-29618796 ATATAGTCATGTTGGGTGTTAGG + Intergenic
1080232708 11:30035613-30035635 ATGCTTTCACACTGGGGGTTAGG - Intergenic
1080310833 11:30889880-30889902 ATATAGTCACAGTAGCGGTTAGG - Intronic
1080512242 11:32986427-32986449 ATACTATCACATTGGGGGTTAGG + Intronic
1081036778 11:38158114-38158136 ATACAGTTACATTGGGGGTTAGG - Intergenic
1081142162 11:39514613-39514635 ATATAGTCACATTAGGGGTTAGG - Intergenic
1081403569 11:42670128-42670150 AAGTAGTCACAATGGAGGTTAGG - Intergenic
1081426454 11:42931375-42931397 ATGCAGTCACATTAGAGGTTAGG - Intergenic
1081565194 11:44256425-44256447 ATGCAGTTACATTGGGGGTTAGG - Intergenic
1081604030 11:44515700-44515722 ATGCATTCCCACTGGGGGTTAGG - Intergenic
1081658301 11:44872329-44872351 ATGAAGTCACGTTGGGGGTTAGG + Intronic
1081953455 11:47067435-47067457 ATATAGTCACATTGGAGGTATGG - Intronic
1082006841 11:47424063-47424085 ATACAGTGACATTGGGGGTTTGG - Exonic
1082757981 11:57096834-57096856 ATTCAGTCACATTGGGAGTTAGG + Intergenic
1082759921 11:57117416-57117438 ATAAAGTCACACTGGGGGTTAGG + Intergenic
1082923598 11:58522188-58522210 ATACAGCCACATTGGGGGTTAGG - Intergenic
1083482891 11:62961081-62961103 ATATAGTCACACTGGGGGTTAGG - Intronic
1083916526 11:65748173-65748195 ATATAGTCACATTGGGGGTTAGG + Intergenic
1083974699 11:66108398-66108420 ATGCAGTCACTTTAGGGATTAGG + Intronic
1084572001 11:69965537-69965559 AAGAAGTCACACTGGGGGCTGGG - Intergenic
1084744530 11:71160335-71160357 ATACCATCACATTGGGGGTTAGG - Intronic
1084918865 11:72452734-72452756 ATACAGTCACATTGGGGGTTAGG + Intergenic
1085150236 11:74246529-74246551 ATACAGTCACATTGGGAATTGGG + Intronic
1085366167 11:75947138-75947160 ATATAGTCACATTAAGGGTTAGG + Intronic
1085536811 11:77226298-77226320 ATACAGTCACACTGAGGGTTAGG - Intronic
1085587045 11:77718541-77718563 ATACAGTCGCATTGGGGATTAGG - Intronic
1085598119 11:77829058-77829080 ATACAGTCACATTAGGGGTTAGG - Intronic
1085712684 11:78844239-78844261 ATACAGTCACATTGGGGGTTAGG - Intronic
1085808522 11:79658836-79658858 ATGCTGTCACATTGGGGTTTAGG + Intergenic
1085839174 11:79990993-79991015 ATATTGTCACATTGGAGGTTAGG - Intergenic
1086339791 11:85837210-85837232 ATACAATCACATTGTGGGTTAGG - Intergenic
1086817581 11:91392463-91392485 ATGAGCTCACATTGGTGGTTAGG + Intergenic
1086996999 11:93369261-93369283 ATGCTGTCACTTTGGGGTTTAGG + Intronic
1087024278 11:93634441-93634463 ATACTATCACATTGGGGGTTAGG + Intergenic
1087186519 11:95204511-95204533 ATACCATCACATTGGGGGTTAGG - Intronic
1087347862 11:96993760-96993782 ATACAGTCACATTGGAGGTTAGG + Intergenic
1087466145 11:98509151-98509173 ATATAACCACATTGGAGGTTAGG - Intergenic
1087597039 11:100267406-100267428 ATGCAACCACATTAGGGGTTAGG + Intronic
1087702185 11:101447825-101447847 ATGCCCTCACATTGGCGGTTAGG - Intergenic
1088350382 11:108880355-108880377 ATACAGCCACATTGGGGGTTAGG + Intronic
1088442258 11:109884547-109884569 ATACAGTCACATTGCGGGTTAGG - Intergenic
1088456666 11:110039923-110039945 ATACAGTCACATTGGTGGTTAGG + Intergenic
1088850191 11:113697922-113697944 ATACAGTCACATTGAGGGTTGGG - Intronic
1088855802 11:113752362-113752384 ATCTAGTCACATTGGGGGCTAGG - Intronic
1089115832 11:116094331-116094353 ATACAGTCACATTGGAGGTCAGG - Intergenic
1089123377 11:116158514-116158536 ATGAAGGGACATTGGGGCTTGGG + Intergenic
1089333898 11:117709491-117709513 ATATAGTCACATGGGGCTTTTGG + Intronic
1089669202 11:120040762-120040784 ATATAGTCACACTGGGGGTTAGG - Intergenic
1089900643 11:121979948-121979970 TTACAGTCACATTAGGGGTTAGG + Intergenic
1089904853 11:122028027-122028049 ATGTAGTACCATTGAGGGGTGGG - Intergenic
1089918426 11:122182871-122182893 ATACCGTCACATTGGGGGTTAGG - Intergenic
1089939913 11:122405293-122405315 ATGTAGTGGCATTGGGAGGTGGG - Intergenic
1090032822 11:123222097-123222119 ATACCATCACATTGGGGGTTAGG - Intergenic
1090195744 11:124815590-124815612 ATGTAATCACATTGGATCTTAGG - Intergenic
1090237707 11:125161576-125161598 ATACGGTCACATTGGGGGTTAGG - Intergenic
1090474533 11:127007526-127007548 ATACAGTCACATTGGAGGTTAGG + Intergenic
1090476069 11:127021638-127021660 ATCCAGCCACACTGGGGGTTAGG - Intergenic
1091275800 11:134348982-134349004 ATACCGTCACAGTGGGGGTTAGG + Intronic
1091496674 12:979092-979114 ATACAGGCACATTGGGGGTTAGG - Intronic
1091497330 12:983873-983895 ATATAGTCACACTGGGAGTTAGG + Intronic
1092466707 12:8739827-8739849 GTGTCATCACATTGAGGGTTAGG + Intronic
1092497215 12:9008769-9008791 ATTTCATCACATTAGGGGTTAGG + Intronic
1092529459 12:9332484-9332506 ATATCATTACATTGGGGGTTAGG - Intergenic
1093130385 12:15384645-15384667 ATGCCGTTACATTGGGGGTTAGG + Intronic
1093301870 12:17468820-17468842 ATAGAATCACACTGGGGGTTAGG + Intergenic
1093379658 12:18477213-18477235 ATTCAGTCACCTTGGGAGTTAGG + Intronic
1093656590 12:21701874-21701896 ATATTATCACATTGGGGGTTAGG - Intronic
1094233832 12:28139793-28139815 ATGCAGTCATATTGGTGATTAGG + Intronic
1094366432 12:29687954-29687976 ATATAGTTACATTGGAGGTCAGG + Intronic
1094681186 12:32668788-32668810 ATATAGTCACTTTGGGAGTTAGG - Intergenic
1094746750 12:33353587-33353609 CTATAATCACAATGGGGGTTAGG - Intergenic
1095159397 12:38899205-38899227 ATATCATCACATTAGGGGTTAGG - Intronic
1095435021 12:42177591-42177613 ATACAGTCACATAGGGGGTGAGG + Intronic
1095494613 12:42771377-42771399 ATAAAATTACATTGGGGGTTTGG + Intergenic
1096266065 12:50123572-50123594 ATGCTGTCCCACTGGGGGTTAGG + Intergenic
1097780826 12:63702725-63702747 ATATTGTCACATTGGTGATTAGG - Intergenic
1097907519 12:64935679-64935701 ATGCAGTCACACTGGGTGTTAGG + Intergenic
1098008126 12:66020847-66020869 ATATAGTCACGTTAGGGTTTAGG - Intergenic
1098163721 12:67672373-67672395 ATACAGACACATTGGGGGTTAGG - Intergenic
1098176684 12:67799420-67799442 ATATAGCCACATTGGGGATTAGG - Intergenic
1098198115 12:68023918-68023940 ATATAGTCACATTAGAGGTTAGG + Intergenic
1098432563 12:70435695-70435717 ATATAGTTACATTGGGGCTTTGG + Intergenic
1098547390 12:71726953-71726975 ATATAGTCACATTAGGGGTTAGG - Intergenic
1098709628 12:73739174-73739196 ATATAGCTACATTGGGGGTTAGG - Intergenic
1098718225 12:73860143-73860165 ATACTATCACATTGGGGGTTAGG - Intergenic
1098940024 12:76523516-76523538 ATGTCATCACATTGGGGATTAGG - Intronic
1099093499 12:78342459-78342481 AAATAGTCACATTGGGGGGTAGG - Intergenic
1099485344 12:83222899-83222921 ACACAGTCACCTTGGGGGTTAGG + Intergenic
1099632923 12:85173786-85173808 ATACCATCACATTGGGGGTTAGG + Intronic
1099751734 12:86782639-86782661 AAACAGTCACATTGGGAGTTAGG - Intronic
1099783548 12:87231636-87231658 ATACAGTCACATTGGGAGTTAGG + Intergenic
1099787841 12:87289068-87289090 ATACAGTCACATTAGGGGTTAGG - Intergenic
1099977833 12:89564759-89564781 ATACAGTCACATTGGGGGTTAGG + Intergenic
1100095861 12:91035449-91035471 ATATAGTTATATTGGGAGTTAGG + Intergenic
1100206029 12:92350833-92350855 ATACCATCACATTGGGGGTTAGG - Intergenic
1100229482 12:92592821-92592843 ATATCATCACATTGGGGGTTAGG + Intergenic
1100593593 12:96052498-96052520 ATACCCTCACATTGGGGGTTAGG - Intergenic
1100599388 12:96099833-96099855 ATGCCATTACATTGGGGGTTAGG + Intergenic
1100606293 12:96154602-96154624 ATGCCATCACATTAGGGGTTAGG - Intergenic
1100947266 12:99800085-99800107 ATACAGTCACACTGGAGGTTAGG - Intronic
1101305796 12:103526621-103526643 ACATAGTCACATTGGGGGTTAGG - Intergenic
1101314655 12:103618168-103618190 ATACAATCACATTGGGGATTAGG - Intronic
1101553306 12:105783723-105783745 ATACCATCACATTGGGGGTTTGG + Intergenic
1101558256 12:105831118-105831140 ATACAGACACACTGGGGGTTAGG - Intergenic
1101579025 12:106025166-106025188 ATACAGTCACATTGGGGATTGGG - Intergenic
1101861362 12:108485065-108485087 ATGTAGTCACATTGGGCGTTAGG - Intergenic
1102348541 12:112175190-112175212 ATGTAGTCACACTGGGGATTAGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1103014200 12:117481300-117481322 ATACAATCAAATTGGGGGTTAGG - Intronic
1103074784 12:117973304-117973326 ATACAGTTACATTGAGGGTTAGG + Intergenic
1103156732 12:118691773-118691795 ATACAGTCACAGTGGGGGTTAGG + Intergenic
1103652805 12:122446132-122446154 ATATCATCACCTTGGGGGTTAGG - Intergenic
1103882698 12:124178628-124178650 ATATAGTCACATTGGGGTTAGGG - Intronic
1104054136 12:125216413-125216435 ATATAGTCACCTTGGGCATTGGG + Intronic
1104285902 12:127424489-127424511 ATACAGTCACATTGGGGTTGAGG - Intergenic
1104404297 12:128504767-128504789 GTGCAGTCACATTGAGGGTTAGG + Intronic
1104469821 12:129020546-129020568 ATGCATTCACATTGGGAGTTAGG + Intergenic
1104510602 12:129374396-129374418 ATACAGTCACATTGAGGGTTAGG + Intronic
1104574394 12:129953594-129953616 ATATTGTCACATTGGAGGTTAGG - Intergenic
1105031113 12:132884538-132884560 ATACAGTCACATTGGGGATTAGG - Intronic
1105381429 13:19891084-19891106 ATAAAGTCACATTGGGTGTCAGG - Intergenic
1105560130 13:21482676-21482698 ATACAGTCATATTGGGGTTTAGG + Intergenic
1105932500 13:25065966-25065988 ATACTGTCACATTGGGGGTTAGG + Intergenic
1105977110 13:25481937-25481959 ATCCCATCACATTGGGGGTTAGG + Intronic
1106501390 13:30332355-30332377 ATACAGTCACCTTGGGGATTAGG - Intergenic
1106551112 13:30771919-30771941 ATATCATCACCTTGGGGGTTAGG - Intergenic
1106679895 13:31999040-31999062 ATATCATCACATTGGAGGTTAGG + Intergenic
1106762021 13:32876815-32876837 ATATCATCACCTTGGGGGTTAGG - Intergenic
1106829106 13:33559455-33559477 ATATCATCACATTGGGAGTTAGG - Intergenic
1106851192 13:33794585-33794607 ATATAGTCACATTGGGCATTTGG - Intergenic
1106891585 13:34252089-34252111 ATTGAGTCACATTAAGGGTTAGG - Intergenic
1107084631 13:36413344-36413366 ATACAGTCACACTGGAGGTTTGG - Intergenic
1107134914 13:36933310-36933332 ATACAATCATATTGGGGGTTAGG - Intergenic
1107146074 13:37061611-37061633 ATACAGTGACATTGGGGTTTGGG + Intergenic
1107300779 13:38963758-38963780 ATATCATCACATTGGGGGTTAGG - Intergenic
1107360586 13:39613377-39613399 ATACCGTCACATTGGGAGTTAGG + Intergenic
1107616053 13:42169528-42169550 TTCTACTGACATTGGGGGTTGGG - Intronic
1107735876 13:43398105-43398127 ATATCATCACCTTGGGGGTTAGG + Intronic
1107799884 13:44095748-44095770 ATTTTTTAACATTGGGGGTTAGG + Intergenic
1107997770 13:45877869-45877891 ATGCAATCACTTTGGGGGTGAGG - Intergenic
1108014597 13:46061413-46061435 ATACAGTCACATTGGGGCTTAGG - Intronic
1108273523 13:48785823-48785845 ATAAAATCACACTGGGGGTTAGG - Intergenic
1108294251 13:48997467-48997489 ATACTGTCACATTGGTGGTTAGG - Intronic
1108548417 13:51519560-51519582 ATATCATCACATAGGGGGTTAGG - Intergenic
1108961382 13:56236252-56236274 ATAAAGTCACAATGGGAGTTAGG + Intergenic
1109380591 13:61554278-61554300 ATACAGTGACATTGAGGGTTAGG + Intergenic
1109493309 13:63132370-63132392 ATAGAGTCACCTTGGGGTTTAGG - Intergenic
1109759275 13:66805792-66805814 ATGCAATCACATTTGAGGTTTGG + Intronic
1110357501 13:74584729-74584751 ATATAGTCACATTAGGGGTTAGG + Intergenic
1110413188 13:75225410-75225432 AAATAGTCACTTTGAGGGTTAGG - Intergenic
1110437883 13:75495597-75495619 ATATACTCACACTGGGGATTAGG - Intergenic
1110445330 13:75573757-75573779 ATATAGTCACGTTGAAGGTTAGG + Intronic
1110455598 13:75687015-75687037 ATACTGTCACATTGAGGGTTAGG + Intronic
1110557299 13:76874814-76874836 ATACAGTAACATTGGGAGTTAGG + Intergenic
1110727602 13:78843290-78843312 ATACAGTCATATTAGGGGTTAGG + Intergenic
1110736546 13:78943571-78943593 ACACAGTCACATTGTGGGTTAGG + Intergenic
1110973498 13:81798728-81798750 AGGTAATCACAGTGGGGCTTAGG - Intergenic
1111561267 13:89951420-89951442 ATACAGTCACATTGATGGTTAGG - Intergenic
1111666812 13:91279587-91279609 ATATAGTCACACTGGGGGTTGGG + Intergenic
1111925278 13:94457242-94457264 GTATAGTCACATTGTGGGTTAGG - Intronic
1111943443 13:94638269-94638291 ATGGAGTCTCATTGTGGTTTTGG + Intergenic
1112074182 13:95890572-95890594 AGAGAGTCACATTGGGAGTTAGG + Intronic
1112108482 13:96268136-96268158 ATATAGTCCCACTGGGGGTTGGG + Intronic
1112130138 13:96514456-96514478 ATACTGTCACATTGGAGGTTAGG - Intronic
1112234571 13:97623987-97624009 ATATAGTCACATTGCCAGTTAGG + Intergenic
1112248216 13:97753911-97753933 ATGCAGTCACATTGTGGGTTAGG + Intergenic
1112251222 13:97782339-97782361 ATATAATCACATTGGAGATTAGG - Intergenic
1112555124 13:100460002-100460024 ATACTGTCACATTGAGGGTTAGG + Intronic
1112682819 13:101786696-101786718 AGGCAATCATATTGGGGGTTAGG + Intronic
1112836871 13:103526316-103526338 ATATAGTCACATTGGGATTTAGG - Intergenic
1112893892 13:104273990-104274012 GTGCAATCACATTGGGGTTTAGG - Intergenic
1113041183 13:106105440-106105462 ATCCAGTCACATTGGTGATTAGG + Intergenic
1113162370 13:107396253-107396275 ATATAGTCAGATTGGGGGTAAGG + Intronic
1113305184 13:109069786-109069808 ATCCAGTTACATTGGGGATTTGG + Intronic
1113308043 13:109099568-109099590 ATATCATCATATTGGGGGTTAGG + Intronic
1113360943 13:109630975-109630997 ATACAGTCACATTGAGGGTTAGG - Intergenic
1113501087 13:110774752-110774774 ATGCCGTCAAATTGGTGGTTAGG + Intergenic
1113502889 13:110792394-110792416 ATGTCGTCACATCGAAGGTTAGG + Intergenic
1113528387 13:111000642-111000664 ATGCAGTCACATTAAGGGTTAGG - Intergenic
1113548263 13:111171780-111171802 ATACTGTCACCTTGGGGGTTAGG - Intronic
1114244711 14:20901748-20901770 ATACAGTGACACTGGGGGTTAGG + Intergenic
1114322705 14:21560343-21560365 ATACAATCACATTGGAGGTTAGG - Intergenic
1114394248 14:22342529-22342551 ATACAGTCACATTGGGGGCTAGG + Intergenic
1114432019 14:22669977-22669999 AGTCAGTCACTTTGGGGGTTAGG - Intergenic
1114520487 14:23331401-23331423 ATATCATCACTTTGGGGGTTAGG - Intergenic
1114690050 14:24573212-24573234 ATGCCATCACATTGGGGATTAGG - Intergenic
1114901024 14:27058175-27058197 ATACCATCACATTGGGGGTTGGG - Intergenic
1115131804 14:30062806-30062828 ATATTGTCACCTTGTGGGTTAGG - Intronic
1115166491 14:30453761-30453783 ATACAGTCACACTGTGGGTTAGG + Intergenic
1115329602 14:32182008-32182030 ATACAGTCACACGGGGGGTTAGG - Intergenic
1115345693 14:32340946-32340968 ATATCATCACCTTGGGGGTTAGG + Intronic
1115375653 14:32672632-32672654 ATATAGTCACATTGGGGGTTAGG + Intronic
1115582611 14:34776660-34776682 ATACAGTCACATTGGAGGTTAGG - Intronic
1115922612 14:38393185-38393207 ATATAGTCACATTGGGGGTGAGG + Intergenic
1115946611 14:38668534-38668556 ATACTATCACATTGGGGGTTAGG - Intergenic
1116070316 14:40035487-40035509 ATGCCATCACATTGAGGGTTAGG + Intergenic
1116112508 14:40604843-40604865 ATGCAGTCACATTGGAGGTTAGG + Intergenic
1116321704 14:43475638-43475660 ATATGGTCACACTGGGGTTTAGG - Intergenic
1116344259 14:43770473-43770495 ATACAGTCACATTGGAGGTGAGG + Intergenic
1116598036 14:46879091-46879113 ATACAATCACATTGGGGATTAGG - Intronic
1116619588 14:47182332-47182354 ATAAAGCCACATTGGGGGTTAGG - Intronic
1116674386 14:47886973-47886995 ATATAGCCACAGTGGTGGTTAGG + Intergenic
1116865747 14:50030191-50030213 ATATAGTCACATTGAGGGTAAGG - Intergenic
1117157586 14:52956388-52956410 ATATCATCACATTGGGGGTTTGG - Intergenic
1117211458 14:53505001-53505023 ATACAGTCACATTGAGGGTTAGG + Intergenic
1117238847 14:53807663-53807685 ATGTACTCAAATGAGGGGTTGGG - Intergenic
1117581338 14:57154393-57154415 ATACAGTCACATTGGGGGATAGG - Intergenic
1117796257 14:59397293-59397315 ATATAGTCATATTGGGTCTTAGG + Intergenic
1117901560 14:60539005-60539027 ATAAAGTCACACTAGGGGTTAGG + Intergenic
1118074076 14:62279599-62279621 ATACAATCACATTGAGGGTTAGG + Intergenic
1118170913 14:63387726-63387748 ATATAGTCACGTTGGGGATTAGG - Intronic
1118495889 14:66307854-66307876 ATATAGTCCCACTGGGGGTTAGG + Intergenic
1118628495 14:67681042-67681064 ATACAGTCACACTGGGGGTTAGG - Intronic
1118838970 14:69496950-69496972 ATACAGTCACATGTGGGGTTAGG + Intronic
1119036373 14:71233015-71233037 ATGCCCTCACCTTGGGGGTTAGG - Intergenic
1119340930 14:73876860-73876882 ATAAAGTCACACTGGGGCTTAGG + Intronic
1119548979 14:75494329-75494351 ATGTGGTCATTTTGGGGGTGGGG + Intergenic
1119577375 14:75738003-75738025 ATGTTTTCACATTGGGTGTAGGG + Intronic
1119577870 14:75743979-75744001 ATGCTGTCACATTGGAGGTTAGG + Intronic
1119685848 14:76630652-76630674 ATAGAGGCATATTGGGGGTTAGG - Intergenic
1119861827 14:77941588-77941610 AAATAGTCACATTTGGGGTTGGG - Intergenic
1119873658 14:78038045-78038067 ATACAGTCACATTGGAGGTTAGG - Intergenic
1120055945 14:79924159-79924181 ATAACTTCACATTGGGGGTTAGG + Intergenic
1120056294 14:79928042-79928064 ATGCCATCACATTGGGGGTTAGG + Intergenic
1120161384 14:81149048-81149070 ATATAGTCACATTGGGAGTTAGG - Intergenic
1120379825 14:83762752-83762774 ATACAGTCTCATTGGGGATTGGG - Intergenic
1120468749 14:84895778-84895800 ATACAGTCACATTGGGGCCTAGG + Intergenic
1120513252 14:85440604-85440626 ATATAGTCACATTGGGCCTTAGG - Intergenic
1120613754 14:86675842-86675864 ATACAGTCCCATTGAGGGTTAGG - Intergenic
1120656261 14:87193694-87193716 ATGTAGTCACACTGGGGATTAGG - Intergenic
1120676975 14:87431909-87431931 ATCTAGTGACATTGGGGGTTAGG - Intergenic
1120943712 14:89974046-89974068 AAATAGTCACATTGGAAGTTGGG + Intronic
1121214176 14:92234443-92234465 ATACAGTAACATTGAGGGTTAGG - Intergenic
1121246063 14:92461666-92461688 ATACAGTTACATTGGGGGTTAGG + Intronic
1121566245 14:94911915-94911937 ATATAGTCACATTTGGTGTTAGG + Intergenic
1121566942 14:94917066-94917088 ATATAGTCACATTGGGGGTTAGG - Intergenic
1121579575 14:95017619-95017641 ATACCATCACATTGGGGGTTAGG + Intergenic
1121896713 14:97655580-97655602 ATATTCTCTCATTGGGGGTTAGG - Intergenic
1121979423 14:98441657-98441679 ATGCCATCACATTAGGGGTTAGG + Intergenic
1122057373 14:99111603-99111625 ATATAGTCACATTGAGGGTTAGG - Intergenic
1122104022 14:99437440-99437462 ATGTAATCACATTGAGGGGTTGG - Intronic
1122160405 14:99780218-99780240 ATACAGTCACATTGGGGGTTGGG + Intronic
1122192051 14:100053129-100053151 TTATAGTCACATTGAGGGTTAGG + Intronic
1122369527 14:101221677-101221699 ATATCATCACTTTGGGGGTTAGG - Intergenic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1122676872 14:103422891-103422913 ATACAGTCACACTGGGGGTTAGG - Intronic
1122827925 14:104380373-104380395 GAACAGTCACATTGGGGGTTAGG + Intergenic
1123727339 15:23116827-23116849 ATATAGTCACATTGAGGATTAGG + Intergenic
1123986428 15:25650367-25650389 ATACTGTCACATTGGGGGTTAGG + Intergenic
1124154120 15:27210039-27210061 AATCAGTCACTTTGGGGGTTAGG + Intronic
1124412099 15:29445104-29445126 ATACAATCACATTGGGTGTTAGG - Intronic
1124851250 15:33340759-33340781 ATAGAGTCACATTTCGGGTTAGG + Intronic
1125049469 15:35279840-35279862 ATACAGTCACGTTGAGGGTTAGG - Intronic
1125108851 15:36006838-36006860 ATATAGTTACATTCTGGGTTAGG - Intergenic
1125152017 15:36543542-36543564 ATATTGTCATACTGGGGGTTAGG + Intergenic
1125397124 15:39261182-39261204 ATACAGTCACAATGGGGGTTAGG + Intergenic
1125768240 15:42149188-42149210 ATACTGTCACATTGGGGGTTAGG - Intronic
1125885222 15:43224319-43224341 ATACAGTCACATTGGGGGTTAGG + Intergenic
1126078362 15:44934779-44934801 CTACAGTCACATTGGGAGTTAGG + Intergenic
1126079485 15:44945567-44945589 CTACAGTCACATTGGGGGTTAGG - Intergenic
1126117925 15:45225872-45225894 ATAAAGTCACACAGGGGGTTAGG + Intergenic
1126796317 15:52262875-52262897 ATACGGTCACATTGGGGGTTAGG - Intronic
1126865808 15:52935482-52935504 ATATAGTCATATTTGGGGTTAGG + Intergenic
1127007493 15:54586579-54586601 ATAAAGTCACATTGGAGGGTGGG + Intronic
1127311964 15:57760292-57760314 ACATAGTCACCTTAGGGGTTTGG + Intronic
1127484061 15:59403251-59403273 ATACAGTCATATTGGGGGTTAGG - Intronic
1127712692 15:61615924-61615946 ATACAATCACATTGGGGATTAGG + Intergenic
1127726344 15:61753658-61753680 ATATCATCATATTGGGGGTTAGG + Intergenic
1127764253 15:62169448-62169470 ATACTGTCACATTGGGGGTTAGG - Intergenic
1128016192 15:64349482-64349504 GTGTAGTTATAGTGGGGGTTGGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1129050993 15:72781798-72781820 ATATAGTCACATTGGGAATTAGG - Intronic
1129078672 15:73020513-73020535 ATATAGTCACATGGAGGGTTAGG - Intergenic
1129490137 15:75916554-75916576 ATATAGTCACATGGGGGGTTAGG + Intronic
1129504313 15:76068506-76068528 GATAAGTCACATTGGGGGTTAGG - Intronic
1129619046 15:77126991-77127013 ATGCAGTAACATTGTGGGCTAGG - Intronic
1129654381 15:77514086-77514108 ATACAGACACATTAGGGGTTAGG + Intergenic
1129703339 15:77780642-77780664 ATACAGTCTCACTGGGGGTTAGG - Intronic
1129903202 15:79167457-79167479 ATATCATCACATTGGGAGTTCGG + Intergenic
1129942104 15:79507183-79507205 ATATAGCCACATTGGGGGTTAGG + Intergenic
1129947390 15:79551002-79551024 ATACAGTTACACTGGGGGTTAGG + Intergenic
1130043612 15:80427034-80427056 ATACTTTCACATTGGGGGTTAGG + Intronic
1130162838 15:81418804-81418826 ATACAGTCATATTGTGGGTTAGG - Intergenic
1130387905 15:83428334-83428356 ATGCCATCACATTAGGGGTTAGG - Intergenic
1130702287 15:86196700-86196722 ATACAGTAACATTGGGGGTTAGG - Intronic
1130702458 15:86198539-86198561 ATTCAATCACATTGGGGATTAGG - Intronic
1130713480 15:86308244-86308266 ATACAATCACATTGGGGATTAGG - Intronic
1130893465 15:88152335-88152357 ATACAGACACAATGGGGGTTAGG - Intronic
1130914962 15:88297880-88297902 GTATAATCACATTGGGAGTTAGG + Intergenic
1131329339 15:91482038-91482060 ATATCATCACTTTGGGGGTTAGG + Intergenic
1131342740 15:91617940-91617962 GTACAGTCACATTGGGGCTTAGG - Intergenic
1131680957 15:94722792-94722814 ATATAGTGACATTGGGGTCTAGG - Intergenic
1131714105 15:95089914-95089936 ATACCATCACATTGGGGGTTAGG - Intergenic
1131895284 15:97021613-97021635 ATACAGTCACTTTGAGGGTTAGG - Intergenic
1131899806 15:97075117-97075139 ATATTGATACATTGGGGGTTAGG + Intergenic
1131939434 15:97544675-97544697 ATATACTCACATTGAGGTTTAGG + Intergenic
1132138323 15:99366717-99366739 ATGCCCTCACACTGGGGGTTTGG + Intronic
1132240110 15:100251386-100251408 CTATAGTCACATTGGGAGTTAGG - Intronic
1133122054 16:3614953-3614975 ATATAGCCAGATTTGGGGTTGGG - Intronic
1133446608 16:5866365-5866387 ATACAATCACAGTGGGGGTTAGG + Intergenic
1133874436 16:9720544-9720566 GTATAGTCACACTGGGGGCTAGG - Intergenic
1134198177 16:12175279-12175301 ATACAATCACATTGGGAGTTAGG - Intronic
1134215689 16:12315489-12315511 ATACATTCACACTGGGGGTTAGG - Intronic
1134259932 16:12642981-12643003 ATATAGCCACATTGGGGTTAGGG + Intergenic
1134429999 16:14194471-14194493 ATGCAGTCACATTGGGGGTTAGG + Intronic
1134768497 16:16783420-16783442 ATACAGTTACATTGGGGGTTAGG - Intergenic
1135281407 16:21156606-21156628 ATCCCATCACATTGGGGGTTAGG + Intronic
1135348649 16:21710472-21710494 ATGCCATCACATTAGGGGTTAGG + Intronic
1135821114 16:25687104-25687126 ATACAGTCACATTGGAGGTTAGG + Intergenic
1136121543 16:28139078-28139100 ATACAGACACATTGAGGGTTAGG - Intronic
1136929139 16:34403277-34403299 ATATCATCCCATTGGGGGTTAGG + Intergenic
1136975435 16:35008527-35008549 ATATCATCCCATTGGGGGTTAGG - Intergenic
1137466345 16:48713301-48713323 ATACAGTCACATTGGGGGTTAGG - Intergenic
1137539178 16:49350279-49350301 ACACAGTCACATTGGGGGTTAGG - Intergenic
1137542296 16:49373052-49373074 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1137721333 16:50629344-50629366 ATACAATCACATTGGGGGTTAGG + Intronic
1137814999 16:51390090-51390112 ATGCAGTTATATTGGGGATTAGG + Intergenic
1137978058 16:53047667-53047689 ATATAGTCACATTGGAGTTCAGG + Intergenic
1138120088 16:54393832-54393854 ATACCGTCACATTGGGGGTTAGG - Intergenic
1138141633 16:54573644-54573666 ATATAGTCACATTGGAGGTTAGG - Intergenic
1138231176 16:55337565-55337587 ATACAGTCACATTAGGGGTTAGG + Intergenic
1138310211 16:56017143-56017165 ATATAGTCACATTGGGGGTTAGG - Intergenic
1138593833 16:58018718-58018740 ATACTATCACATTGGGGGTTAGG + Intronic
1138640820 16:58385141-58385163 ATTTAGTCACATTAAAGGTTAGG - Intronic
1138903338 16:61301034-61301056 ATGTAGTCACATTGGGGTTTAGG - Intergenic
1139263340 16:65616793-65616815 ATATAGTCACATTGGGGGTTGGG - Intergenic
1139294365 16:65887384-65887406 ATATAGTCACTTTGGGGGTTAGG - Intergenic
1140585883 16:76291090-76291112 ATAAAGTCACATTGGGGATTAGG + Intronic
1140596411 16:76419974-76419996 ATACAGTCACATTGTGGGTTAGG + Intronic
1140604185 16:76515306-76515328 ATATAGTCACATTGGGGTTAGGG - Intronic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1140764665 16:78145858-78145880 ATGCAGTCATGTTGGGGGTTAGG + Intronic
1140966671 16:79973068-79973090 ATATAGTCACACAGGAGGTTAGG - Intergenic
1141062335 16:80884909-80884931 ATGCAGTCACATTGAGGGTTGGG + Intergenic
1141215898 16:82023580-82023602 ATACCATCACATTGGGGGTTAGG + Intergenic
1141328175 16:83082132-83082154 ATGTTATCACATTGGGGTTTAGG + Intronic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143868009 17:9938103-9938125 ATGCAGCCACATTGTGGGTTAGG - Intronic
1144044005 17:11438672-11438694 ATATAGTTACACTGGGAGTTAGG + Intronic
1144102373 17:11953126-11953148 ATACAGTCACATGGAGGGTTGGG + Intronic
1144114853 17:12078046-12078068 GTACAGTCACATTTGGGGTTAGG + Intronic
1144125904 17:12202713-12202735 ATACCATCACATTGGGGGTTAGG - Intergenic
1144257528 17:13484388-13484410 ATCTAATCACATTGAGGATTAGG - Intergenic
1144537726 17:16107277-16107299 ATACAGTTACATTGGGGGGTAGG - Intronic
1145838569 17:27974348-27974370 ATATAGCCACATCGGGGGATAGG + Intergenic
1145923805 17:28631100-28631122 ATACTGTTACATTGGGGGTTAGG - Intronic
1146297249 17:31659518-31659540 ATACAGTCACATTAAGGGTTAGG + Intergenic
1146484874 17:33234835-33234857 ATGCCATCACATTAGGGGTTAGG + Intronic
1146545515 17:33734594-33734616 ATACAGTCACAATGGGGGTGAGG - Intronic
1146580061 17:34029539-34029561 CTACAGTCATATTGGGGGTTAGG - Intronic
1146892825 17:36517736-36517758 ATGCAGTCACATTGGGAGTGAGG - Intronic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1148019717 17:44545594-44545616 ATACAATCACATTGAGGGTTAGG - Intergenic
1148149843 17:45390126-45390148 ATGCCATCACATTGAGGGTTAGG - Intergenic
1148965260 17:51429568-51429590 ATGTAGTCACACTGGGGCCTAGG + Intergenic
1149173832 17:53845518-53845540 TTGAAGTCACATTAGGGATTTGG - Intergenic
1149209143 17:54284004-54284026 CTGTAGTCAGATTGTGGCTTGGG - Intergenic
1149297712 17:55275507-55275529 ATATAGTGACCTTGGGGGTAAGG + Intronic
1149443739 17:56697694-56697716 ATATAGTCACATTGGGGGTTAGG + Intergenic
1149573666 17:57696037-57696059 ATACAGCCACACTGGGGGTTAGG + Intergenic
1149587101 17:57798108-57798130 ATAAAGTCACATCGTGGGTTGGG + Intergenic
1149628771 17:58101938-58101960 ATCTTATCACATTGAGGGTTAGG + Intergenic
1149707196 17:58705728-58705750 ATACATTCACATTGGGGTTTAGG + Intronic
1149743347 17:59069715-59069737 ATACAGTCACATTGGGGGTTAGG - Intronic
1149766627 17:59284283-59284305 ATACAGTCACACTGGGGGTCAGG + Intergenic
1150032582 17:61754923-61754945 ATATAACCACACTGGGGGTTAGG + Intronic
1150088991 17:62303492-62303514 ATACAGTCACATTGGGGATTAGG + Intergenic
1150511461 17:65756931-65756953 ATACAGTCAAATTGGGGTTTAGG - Intronic
1150603932 17:66675344-66675366 ATGTCATCGCCTTGGGGGTTAGG + Intronic
1150845135 17:68649445-68649467 ATATGGTCACATTCGAGGTTAGG - Intergenic
1151138329 17:71968763-71968785 ATGTAGTCACACTGGGTGTTAGG - Intergenic
1152792292 17:82287840-82287862 ATGCAGTCACATCGGGGGCTAGG - Intergenic
1152908514 17:82983815-82983837 ATACAGTCACATTGGGAGTTAGG - Intronic
1153214990 18:2811173-2811195 ATACAGTCACACTGGAGGTTAGG - Intergenic
1153263232 18:3244384-3244406 ATACAGTCACACTGGGGGTTAGG - Intergenic
1153433871 18:5048199-5048221 ATGCCATCACAGTGGGGGTTAGG + Intergenic
1153677962 18:7472473-7472495 ATATAGTCACATAGGGGCTTAGG - Intergenic
1153912174 18:9713972-9713994 ATATCCTCACATTGGAGGTTAGG + Intronic
1154273315 18:12938531-12938553 ACATAGTCAGATTAGGGGTTAGG - Intergenic
1155028356 18:21962461-21962483 ATACAGTCACATTGGGGGTTAGG + Intergenic
1155233406 18:23795869-23795891 ATACAGTCACACTGGGGGTTAGG - Intronic
1155260651 18:24038973-24038995 ATATAGTCAAATTAGGGGTTAGG + Intronic
1155319509 18:24605205-24605227 TTGTAATCACATTGGGGGTTAGG - Intergenic
1155397178 18:25398661-25398683 ATACAGTCACATTGGAGCTTAGG - Intergenic
1155656125 18:28195080-28195102 ATACAGTCACATTGGGATTTAGG + Intergenic
1155833030 18:30541956-30541978 ATAACATCACATTGGGGGTTAGG + Intergenic
1155939707 18:31791053-31791075 ATACAGTCACATTAGGGATTAGG - Intergenic
1156034993 18:32756077-32756099 ATGTAGTCACTTTGGGGGTTAGG - Intronic
1156260877 18:35444188-35444210 ATACAGTCACATTTGGGGTTAGG + Intronic
1156399779 18:36729736-36729758 ATATCATCACTTTGGGGGTTAGG + Intronic
1156461582 18:37324257-37324279 ATACAGTCACAATGGGGGTTAGG - Intronic
1156603912 18:38643282-38643304 ATATGGTTACATTGAGGGTTAGG + Intergenic
1156729095 18:40168566-40168588 ATATCATCATATTGGGGGTTAGG - Intergenic
1156891857 18:42199225-42199247 ATACAGTCACACTGGGGGTTAGG + Intergenic
1157042542 18:44057839-44057861 ATGCCATCACATTGGGAGTTAGG + Intergenic
1157103404 18:44750452-44750474 ATATCATCACACTGGGGGTTAGG + Intronic
1157111912 18:44828709-44828731 ATACAGTCACATTGGGAGTTAGG - Intronic
1157170800 18:45403307-45403329 ATACAGTCACACTGGGGATTAGG + Intronic
1157348589 18:46863811-46863833 ATACAGTCACATTGGGGGTTAGG - Intronic
1157840869 18:50957142-50957164 ATACAGTCACATTGAGGTTTAGG + Intergenic
1158028610 18:52934657-52934679 ATACAGTCACATTGGGGGTTAGG - Intronic
1158226896 18:55210816-55210838 ATACAGTTACATTGGGGGTTAGG - Intergenic
1158303124 18:56075189-56075211 ATACAGTTACATTAGGGGTTAGG + Intergenic
1158348267 18:56537966-56537988 ATTTAGTCACATTGGGGATTAGG - Intergenic
1158399246 18:57105986-57106008 ATACAGTCACACTGGGAGTTAGG + Intergenic
1158550668 18:58433252-58433274 ATGATGTCTCAATGGGGGTTAGG - Intergenic
1158598146 18:58834440-58834462 ATACATTCACATTGGGAGTTAGG - Intergenic
1158599222 18:58842765-58842787 ATATAATCACATTGAGGGCTAGG + Intergenic
1158876726 18:61741144-61741166 ATATCATCACTTTGGGGGTTGGG + Intergenic
1158886831 18:61836372-61836394 ATGTCATCACATTGGGGATTAGG - Intronic
1159243246 18:65771156-65771178 AATCAGTCACATTGGGAGTTAGG + Intronic
1159248366 18:65839481-65839503 ATGGCATCACCTTGGGGGTTAGG + Intronic
1159280288 18:66276214-66276236 ATATAGTCACATTAGGGGTTAGG - Intergenic
1159399880 18:67917105-67917127 ATACACTCACATTGGAGGTTAGG + Intergenic
1159521583 18:69531890-69531912 ATATCATCACATTGGGGATTAGG - Intronic
1159579012 18:70213996-70214018 ATACAATCACACTGGGGGTTAGG + Intergenic
1159579490 18:70219062-70219084 ATACAGTAACATTGAGGGTTAGG + Intergenic
1159580600 18:70230872-70230894 ATACAGCCACATTGGGGGTTAGG + Intergenic
1159611950 18:70535569-70535591 CTATAGTCACATTAGGGGTTAGG + Intergenic
1159807997 18:72978716-72978738 ATGCTATCACATTCGGGGTTAGG + Intergenic
1160666263 19:330616-330638 ATATAGTCATGTTGGGGCTTAGG - Intronic
1160949464 19:1658530-1658552 ACGTGGTCTCACTGGGGGTTGGG + Intergenic
1161750081 19:6089482-6089504 ATGCCGTCATATTGGGGGTTAGG - Intronic
1162150770 19:8644056-8644078 ATTCAGTCACACTGGGGTTTGGG - Intergenic
1162282308 19:9709039-9709061 ATACACTCACATTGGGGTTTGGG - Intergenic
1162300862 19:9844143-9844165 ATGCAGCCACACTGGAGGTTAGG + Intronic
1162994494 19:14325560-14325582 ATATAGTCACATTGGGGGTTAGG + Intergenic
1163311927 19:16520065-16520087 ATGTGGAAACATTGGTGGTTAGG - Intronic
1163612276 19:18307815-18307837 ACTAAGTCACATTGGGGGTTGGG + Intronic
1163836600 19:19578778-19578800 AAATAGTCACGTTGGGAGTTAGG - Intronic
1164427296 19:28152994-28153016 GTACAGTCACATTAGGGGTTAGG - Intergenic
1164536861 19:29092666-29092688 ATGTCATCACCTTGGGAGTTAGG - Intergenic
1164861693 19:31566847-31566869 ATACCGTCACATTGGGGGTTAGG - Intergenic
1165171713 19:33897025-33897047 ATACAGTCACACTGGGGATTAGG - Intergenic
1165252379 19:34550597-34550619 ATACAATCACACTGGGGGTTAGG + Intergenic
1165267441 19:34672928-34672950 ATATTGTCACACTGGGGATTCGG + Intronic
1165281241 19:34799575-34799597 ATATAGTCACACTGGGGTTAGGG - Intergenic
1165642317 19:37400100-37400122 ATATTGTCACATTAGGGATTAGG + Intergenic
1166968783 19:46548052-46548074 ATACAGTCGTATTGGGGGTTGGG - Intronic
1166993620 19:46708204-46708226 ATATAGTTGCATTGGAGGTTAGG - Intronic
1167754911 19:51406430-51406452 ATATCATTACATTGGGGGTTAGG + Intergenic
1168580619 19:57552922-57552944 ATACAGTCACGTTGGGTGTTAGG - Intronic
925084274 2:1095212-1095234 ATGCAGTCACACTGGAGGTCAGG + Intronic
925473812 2:4191200-4191222 ATATAGTCACATTTAGGGTAAGG - Intergenic
925693245 2:6547124-6547146 ATACTGTCACATTGGGAGTTGGG + Intergenic
925739195 2:6990638-6990660 ATATAGTCCCAATGGGGGTTTGG + Intronic
925767763 2:7253506-7253528 ATACCATCACATTGGGGGTTAGG - Intergenic
925772867 2:7300581-7300603 ATGTGGTGAAATTGGGGGGTGGG - Intergenic
926109711 2:10174008-10174030 ATGCAGCCACACTGGGGGTTTGG - Intronic
926215846 2:10904926-10904948 ATAGCATCACATTGGGGGTTAGG + Intergenic
926266615 2:11328186-11328208 AATTAGTCGCATTGGGGTTTTGG - Intronic
926310938 2:11675840-11675862 ATACAGTCACACTGGGAGTTTGG - Intergenic
926391179 2:12394435-12394457 ATACAGTCATATAGGGGGTTAGG + Intergenic
926421724 2:12706728-12706750 ATATAATCATATTGGGGGTTAGG - Intergenic
926441626 2:12895137-12895159 ATGTAGTCACATTGAGCATTAGG - Intergenic
926582581 2:14647517-14647539 ATATCATCACTTTGGGGGTTAGG - Intronic
926596311 2:14792913-14792935 ATATAGTCACATTGGGGGTTAGG - Intergenic
926608583 2:14922667-14922689 ATACAGTTACATTGGGGGTTAGG + Intergenic
926775161 2:16414921-16414943 ATTCCGTCACATTGGGGTTTAGG - Intergenic
926805085 2:16700921-16700943 ATAGAGTCATATTGGTGGTTAGG + Intergenic
927365250 2:22287364-22287386 ATACAGTCACATTGGGGGTTAGG + Intergenic
927423406 2:22955896-22955918 ATACAGTCATAGTGGGGGTTAGG + Intergenic
927512335 2:23651964-23651986 ATACAATCACATTGGGGATTAGG + Intronic
927789163 2:25996638-25996660 ATACTGTCACCTTGGGGGTTAGG + Intergenic
928275446 2:29896378-29896400 ATGCAGTCACATTGGGGATTAGG - Intronic
928357306 2:30630287-30630309 GTATAGTCACATTGGGGGTTAGG + Intronic
928415436 2:31087817-31087839 ATGCCATCACATTGGGGTTTAGG - Intronic
928431528 2:31222829-31222851 ATGTGATCACACTGGGGGTCAGG - Intronic
928611498 2:32996403-32996425 ATATTGTCGTATTGGGGGTTAGG + Intronic
928702070 2:33909143-33909165 ATCCAGTCACATTAGGGGTTAGG + Intergenic
928861332 2:35860983-35861005 ATGTCGTCACCTTGGGGGTTAGG - Intergenic
928940811 2:36725550-36725572 ATATCATCACACTGGGGGTTAGG + Intronic
929029524 2:37637419-37637441 ATATAGTCACACTGAGGGTTAGG + Intergenic
929217048 2:39425433-39425455 ATGCTGCCACATTGAGGGTTAGG - Intronic
929596737 2:43180739-43180761 ATGGAGTCAGATTAGGGGTACGG - Intergenic
929794138 2:45046076-45046098 ATGCTGTCACAATGGAGGTTAGG + Intergenic
929797826 2:45073609-45073631 ATACTGTCACTTTGGGGGTTAGG - Intergenic
929985816 2:46731168-46731190 ATATAATCACACTGGGGATTAGG - Intronic
930001529 2:46864913-46864935 ATACCATCACATTGGGGGTTAGG + Intergenic
930248928 2:49013805-49013827 ATATCATCACATTGAGGGTTAGG - Intronic
930334853 2:50032617-50032639 AATAAGTCACATTGGGGGTTAGG - Intronic
930392954 2:50784960-50784982 AAACAGTCACATTGGGAGTTAGG - Intronic
930749945 2:54925045-54925067 ATACAGTCCCATTGGGAGTTAGG - Intronic
931019968 2:58033013-58033035 ATATCATCACATTGGGTGTTAGG + Intronic
931105568 2:59051586-59051608 ATGTCATCACACTGGGGATTAGG + Intergenic
931122881 2:59240084-59240106 ATGTAGTCAAATTGGGGTTGTGG + Intergenic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
931157486 2:59652053-59652075 ATATAGTCACATTGAGGCTTAGG - Intergenic
931382635 2:61767568-61767590 ATACAGTCACATTGGGGGCTGGG + Intergenic
931536875 2:63287213-63287235 ATATAGTCACATTGAAGGTCAGG + Intronic
931945753 2:67305504-67305526 ATGTCATCACATTGGGCATTAGG - Intergenic
931945841 2:67306272-67306294 ATGTCATCACATTGGGCATTAGG + Intergenic
932020317 2:68077943-68077965 ATGCAGTCACATTGAGGGTTAGG + Intronic
932266023 2:70367492-70367514 TTATAGTCACATTGGGGGTTAGG + Intergenic
932299139 2:70653089-70653111 ATACAATCACATTGGGGATTAGG - Intronic
932989196 2:76765447-76765469 ATGTAGCCATACTGAGGGTTAGG - Intronic
933100031 2:78243903-78243925 ATACCATCACATTGGGGGTTAGG - Intergenic
933258123 2:80103456-80103478 ATGCAGGCATATTGGAGGTTAGG + Intronic
933364977 2:81341042-81341064 ATGCAGTTACATTGAGGGTTAGG + Intergenic
933585261 2:84173284-84173306 ATACAGTCACCTTGGGGATTAGG + Intergenic
933726126 2:85428439-85428461 AAATAGTCACATGGGGGGTTAGG - Intronic
933993566 2:87651088-87651110 ATATGATCACCTTGGGGGTTAGG - Intergenic
934546029 2:95217277-95217299 ATGAATTCACATTGGGGATTAGG + Intronic
934546221 2:95218905-95218927 ATATAGTCACATTGAGGGTTAGG + Intronic
934697754 2:96412376-96412398 ATGTAGTCACATTGGTGGTGAGG - Intergenic
934719248 2:96561793-96561815 ATGCAGCCATATTAGGGGTTAGG - Intergenic
935036297 2:99377736-99377758 ATATAGTCATATGAGGGGTTAGG + Intronic
935154217 2:100468230-100468252 ATACAGTCACATTGGGGTCTAGG + Intergenic
935241667 2:101183627-101183649 ATATTGTCACATTAGGGGTGAGG + Intronic
935322432 2:101902139-101902161 GTGCAGTCACACTGGGGGTGAGG - Intergenic
935475449 2:103515301-103515323 AGATAGTCTCATTGGGGTTTAGG - Intergenic
935563204 2:104579196-104579218 ATACAGTCACAATGGGGGTTAGG + Intergenic
935660798 2:105465249-105465271 ATACAGTCATACTGGGGGTTAGG + Intergenic
935716133 2:105940488-105940510 ACACAGTCACATTAGGGGTTAGG + Intergenic
935892905 2:107699345-107699367 ATACAGTCACATTGGTGTTTAGG - Intergenic
936159822 2:110076454-110076476 ATACAGTTGCATTGGGGGTTAGG + Intergenic
936184843 2:110294899-110294921 ATACAGTTGCATTGGGGGTTAGG - Intergenic
936255513 2:110907331-110907353 AAATAGTCACATTGGTTGTTAGG + Intronic
936300297 2:111299795-111299817 ATATGATCACCTTGGGGGTTAGG + Intergenic
936450925 2:112633579-112633601 ATGTTATCACATTGGGAATTAGG - Intergenic
936753105 2:115670225-115670247 ATATCATCACATTGGGGATTAGG + Intronic
936895522 2:117423335-117423357 ATGTAATCACACGGGAGGTTAGG + Intergenic
936928455 2:117761956-117761978 ATATAGTAACCTTAGGGGTTAGG + Intergenic
937332932 2:121043379-121043401 ATATTGCCACATTGGGGGTTAGG - Intergenic
937423800 2:121780375-121780397 ATACAGTCACATTGGTGGTTAGG + Intergenic
937441017 2:121916101-121916123 ATATCATCACATTGGGGATTAGG + Intergenic
937441722 2:121921083-121921105 ATATAATCACATTTGGGGGTGGG + Intergenic
937445036 2:121950289-121950311 ATAGAGTCACATTTGGGGTTAGG - Intergenic
937536216 2:122891260-122891282 ATGTAATCAGATTGGAAGTTAGG - Intergenic
937649278 2:124301903-124301925 ATATAGTCACTTTGGAAGTTAGG - Intronic
938055750 2:128213479-128213501 ATACAGTCACATGGGGGCTTGGG - Intergenic
938100056 2:128492507-128492529 ATGCAGTTATATTGGGGGCTGGG - Intergenic
938373544 2:130789343-130789365 ATACAGTCACATTGGGAGTTAGG - Intergenic
938389186 2:130891798-130891820 ATGCAGTCACATTGGGTACTGGG + Intronic
938579805 2:132635735-132635757 ATACAGTCAGATTTGGGGTTAGG - Intronic
938626093 2:133111092-133111114 ATACAGTCACATCAGGGGTTAGG + Intronic
938664617 2:133521762-133521784 ATACAGTCACATTGGGAGTTAGG + Intronic
939045059 2:137240056-137240078 ATGTTTTCACTTTGGGGGTTAGG + Intronic
939256578 2:139751253-139751275 ATACAGTCACATTGTGGGTTAGG + Intergenic
939259201 2:139784871-139784893 ATGTAATCACATTGGAGGTTAGG + Intergenic
939347260 2:140981792-140981814 ATGGAGTAACATTTGGGGTAAGG - Intronic
939444934 2:142296994-142297016 ATACAGTCACAGTGGGGATTAGG + Intergenic
939471732 2:142630863-142630885 GTACAGTTACATTGGGGGTTAGG - Intergenic
939660360 2:144881448-144881470 GTGTCTCCACATTGGGGGTTAGG + Intergenic
939791627 2:146585298-146585320 ATACAGTCACATTGAGGGTTAGG + Intergenic
939808811 2:146807226-146807248 ACACAGTCACATTGTGGGTTGGG + Intergenic
939944305 2:148390370-148390392 ATGCAGTCACTTTAGGGGTTAGG + Intronic
939956297 2:148530303-148530325 AAACAGTCACATTGGGGGTTAGG - Intergenic
939985714 2:148827711-148827733 AAATAGTCACATTGGCGATTAGG - Intergenic
939993220 2:148895995-148896017 ATACAGTCACATTGGGTGTTAGG + Intronic
940122083 2:150278230-150278252 ATATCATCACATTGGAGGTTAGG - Intergenic
940214674 2:151292246-151292268 ATACTGTCACCTTGGGGGTTAGG - Intergenic
940356178 2:152745212-152745234 ACGTCTTCACATTGAGGGTTAGG + Intronic
940448162 2:153803289-153803311 ATGTAATTATATTGGGGGCTAGG - Intergenic
940550882 2:155154745-155154767 GGACAGTCACATTGGGGGTTAGG + Intergenic
940703815 2:157078985-157079007 ATTCAGTCACATTGTGGGTTAGG - Intergenic
940778402 2:157907666-157907688 ATGCAGTCACATTGGGGGTTGGG + Intronic
941142510 2:161802924-161802946 ATACAGTCACATTTGGGGTTGGG + Intronic
941260907 2:163295718-163295740 ATGGCATCACATAGGGGGTTAGG + Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941578088 2:167260832-167260854 ATATAGTCATATTGGGGTTTAGG + Intergenic
941659952 2:168186024-168186046 ATATAGTCACATTGGGGATTAGG - Intronic
941697505 2:168569309-168569331 AGGCAGTCACATTGGGAGGTAGG + Intronic
941810685 2:169753479-169753501 ATATAGTCACATTGAGAGTTGGG - Intronic
941957786 2:171221906-171221928 ATACAGTCACATGGGGGGTTAGG + Intronic
941976057 2:171406655-171406677 ATAAAGTCACATTGTGGGGTAGG + Intronic
942222129 2:173780597-173780619 ATACCATCACATTGGGGGTTAGG - Intergenic
942512938 2:176722220-176722242 ATATAGTCACCCTGGGGATTGGG - Intergenic
942594860 2:177583300-177583322 ATGTAGTCACATGGGGGTTTAGG + Intergenic
942775748 2:179580496-179580518 ATACAGTCACGTTGGTGGTTAGG - Intronic
942942063 2:181630445-181630467 ATACAGTCACACTGGGGGTTAGG - Intronic
943296183 2:186142794-186142816 ATATAGCCACATTGGGGGTTAGG - Intergenic
943381619 2:187156883-187156905 ATATAGTTACATTGTGGGTTAGG + Intergenic
943409538 2:187529618-187529640 ATGCAGTCACATTGGGGGTTAGG + Intronic
943489293 2:188530464-188530486 ATATAGTCATATTAGGGGTTAGG - Intronic
943623018 2:190170248-190170270 ATATGATCACATTGGGGATTAGG + Intronic
943631188 2:190254168-190254190 ATGCAGTTACATCGAGGGTTAGG - Intronic
943719506 2:191189060-191189082 ATACCATCACATTGGGGGTTAGG + Intergenic
943856647 2:192802380-192802402 ATATAGCCATACTGGGGGTTAGG + Intergenic
943949432 2:194111826-194111848 AGATAGTCATGTTGGGGGTTTGG + Intergenic
943973650 2:194443193-194443215 ATGCAGTCAAAATGAGGGTTAGG + Intergenic
944051082 2:195470625-195470647 ATATAGTCACACTGGAGATTAGG - Intergenic
944209044 2:197187500-197187522 ATACAGTCGCTTTGGGGGTTAGG - Intronic
944233194 2:197416372-197416394 ATACAGTCACACTGGGGGTTAGG - Intronic
944360878 2:198854979-198855001 ATGCCATCACCTTGGGGGTTAGG - Intergenic
945161026 2:206890624-206890646 ATATTGTCACATTGAGGGTTAGG - Intergenic
945195718 2:207235738-207235760 ATGCCATCACATTGGGGGTTAGG + Intergenic
945259410 2:207830265-207830287 ATATAGTCACATTGTGGGTAAGG - Intronic
945323421 2:208454313-208454335 ATAGAGTCACATTGGGGGTTAGG - Intronic
945333087 2:208561870-208561892 ATACCATCACATTGGGGGTTAGG - Intronic
945359518 2:208880134-208880156 ATATCATCACATTGGGGGCTGGG - Intergenic
945626188 2:212209636-212209658 ATGTAGTCACTCTAAGGGTTTGG - Intronic
945636908 2:212366950-212366972 ATACAGTCACATTGGGGGTTAGG - Intronic
945876178 2:215280311-215280333 ATATAGTCATGTTGGGGGTTAGG - Intergenic
945992616 2:216408752-216408774 ATATGGTCACAGTAGGGGTTAGG - Intergenic
946079284 2:217103259-217103281 ATACCGTCACCTTGGGGGTTAGG + Intergenic
946088288 2:217196479-217196501 ATGTGGTCCCATTAGGGCTTAGG - Intergenic
946128123 2:217582266-217582288 ATACAATCACCTTGGGGGTTAGG - Intronic
946319989 2:218947385-218947407 ATATCATCACATTGGGTGTTAGG + Intergenic
946533735 2:220604598-220604620 ATACAGTCACATTGGGGGTTAGG + Intergenic
946572100 2:221035569-221035591 ATTTAGTCACATTGTGGATTAGG - Intergenic
946618623 2:221536508-221536530 ATGTAATCACATTGGGGGTTAGG - Intronic
946667783 2:222068754-222068776 ATACAGCCACATTGGGGATTAGG + Intergenic
946773411 2:223112523-223112545 ATACAGTCACATTGGGGGTTAGG + Intronic
946881273 2:224179580-224179602 ATGCTGTCACACTGGGGATTAGG + Intergenic
946986449 2:225279393-225279415 ATATCGTCACATTGAGGGTTAGG - Intergenic
947095747 2:226564606-226564628 AAACAGTCACATTGGAGGTTAGG + Intergenic
947095929 2:226566749-226566771 ATATAGTTGCATTGGGGGTTAGG + Intergenic
947133729 2:226955868-226955890 ATACAGTCACATTGGGGGTTAGG + Intronic
947136883 2:226984519-226984541 ATGCCATCACATTGAGGGTTTGG + Intronic
947358891 2:229326291-229326313 ATATCATCACTTTGGGGGTTAGG - Intergenic
947647555 2:231754955-231754977 ATACCATCACATTGGGGGTTAGG - Intronic
947654405 2:231813840-231813862 ATACAGTCACATTGGGGGTTAGG + Intergenic
947702641 2:232247573-232247595 ATACGGTCACACTGGGGGTTAGG + Intronic
947950423 2:234142382-234142404 ATACAGTCACATTGGGGGTTAGG - Intergenic
948102967 2:235390048-235390070 ATGCAGTCACATCAGGGGTTAGG + Intergenic
948259247 2:236590695-236590717 ATATAGCCACACTGGGGGTGAGG + Intergenic
948410554 2:237756547-237756569 ATACAGTCACATTGGGCATTAGG + Intronic
1168787372 20:551623-551645 ATAGTGTCACATTGGGTGTTAGG - Intergenic
1168862652 20:1056957-1056979 ATATAGCCACATTGGGCTTTAGG - Intergenic
1169054077 20:2605599-2605621 AAATAGTCACATTGAGAGTTAGG + Intronic
1169713253 20:8588452-8588474 ATAAAGTCACATTAGGGGTTAGG - Intronic
1169733133 20:8808488-8808510 ATATAATCACATTGAGGGTTAGG + Intronic
1169938747 20:10914224-10914246 ATACAGTCACACTGAGGGTTAGG - Intergenic
1170022348 20:11850417-11850439 ATTTAGTCACCTTGGGGATTAGG - Intergenic
1170148724 20:13205700-13205722 ATGCCATCACATTGGGGATTAGG + Intergenic
1170226045 20:13992958-13992980 ATTTAGTCACATTGGAGATTAGG + Intronic
1170504335 20:17009138-17009160 ATGCAGTCACATTAGGGTTAGGG + Intergenic
1170671658 20:18439917-18439939 ATACAATCACATTGGGGGCTGGG - Intronic
1170728396 20:18949675-18949697 ATACAATCACATTGGGGGTTAGG + Intergenic
1170753895 20:19179416-19179438 ATACAGTCATATTGGGAGTTTGG + Intergenic
1171322932 20:24262327-24262349 ATGCAGCCACACTGGGGGTGGGG - Intergenic
1172911932 20:38415996-38416018 ATATAGTTACATTGAGGGTTAGG - Intergenic
1172942603 20:38664681-38664703 ATGCACTCACCTTGGGGGTTAGG + Intergenic
1173109045 20:40168171-40168193 CTTCAGTCACATTGAGGGTTAGG + Intergenic
1173184200 20:40828167-40828189 ATATAGCCACTTTGGGGGTTAGG - Intergenic
1174820094 20:53719193-53719215 ATACAGTCACATTTGAGGTTAGG - Intergenic
1174851997 20:54004769-54004791 ATGTAGTCACATTGAGGGTTAGG - Intronic
1174920396 20:54696131-54696153 ATATAGTCACACTGGGAGTCAGG - Intergenic
1175588780 20:60170196-60170218 ATACAGTCACATTGGGAGTTAGG - Intergenic
1176993215 21:15522643-15522665 ATATCATCATATTGGGGGTTAGG + Intergenic
1177054078 21:16277667-16277689 GTATAGTCACACTGCGGGTTAGG + Intergenic
1177069934 21:16492198-16492220 ATGCTATCACATTGGGGGTTAGG - Intergenic
1177264740 21:18767499-18767521 AAACAGTCACATTGTGGGTTAGG + Intergenic
1177340123 21:19787563-19787585 ATATCATCACATTGAGGGTTAGG + Intergenic
1177379978 21:20327201-20327223 ATATTGTCTCATTGGGGGTTAGG + Intergenic
1177421271 21:20861007-20861029 ATACAGTCACATTGGAGGTCAGG - Intergenic
1177529069 21:22337117-22337139 ATGTAGGCACATTGTGGGTCTGG - Intergenic
1177549671 21:22604019-22604041 ATATAGTCACATTACGGATTAGG - Intergenic
1177714168 21:24817734-24817756 ATATCATCACATTGGGGATTAGG - Intergenic
1177717364 21:24856197-24856219 ATGCAGTCATATTGAGTGTTAGG + Intergenic
1178053052 21:28768771-28768793 ATATAGTCACATCAGAGGTTAGG - Intergenic
1178169352 21:30021438-30021460 ATATCATCACTTTGGGGGTTAGG - Intergenic
1178343457 21:31805418-31805440 ATACCATCACATTGGGGGTTAGG + Intergenic
1178356665 21:31914862-31914884 ATACAGTCACGTTGGGGGTTAGG + Intronic
1178523990 21:33309904-33309926 ATACAGTCACATTGGGGATTAGG - Intergenic
1178676716 21:34637368-34637390 ATATAGTCACATTGGAGGTTAGG + Intergenic
1178738305 21:35172323-35172345 GTATAGTCACACTGGGGGCTAGG - Intronic
1179027857 21:37694733-37694755 GTACAGTCACATTGGGAGTTAGG - Intronic
1179029036 21:37703920-37703942 ATGGAGTCACATCCTGGGTTTGG - Intronic
1179058844 21:37960671-37960693 ATATCATCACCTTGGGGGTTAGG + Intronic
1179108392 21:38424056-38424078 ATATCATCACATTGGGAGTTAGG - Intronic
1179155066 21:38842641-38842663 ATACAGTCCCATTGGTGGTTGGG - Intergenic
1179357258 21:40672184-40672206 ATACAGTCACATTGGGGGTTAGG + Intronic
1179368784 21:40784609-40784631 ATAACATCACATTGGGGGTTAGG - Intronic
1179446630 21:41436353-41436375 ATACAGTCCCATTAGGGGTTAGG + Intronic
1179900780 21:44392668-44392690 CTATAGTCACACTGGGGGTTAGG + Intronic
1179968773 21:44821935-44821957 ATGAAATCACATTGGAGGTCAGG + Intergenic
1180088444 21:45520614-45520636 ATGCAGTGACATTGTGGGTTAGG - Intronic
1180255949 21:46627621-46627643 ATACAGTCACATTGGGGATTGGG - Intergenic
1180641405 22:17302373-17302395 ATGCAGTCACATTGAGGGCCAGG - Intergenic
1180798360 22:18619120-18619142 ATGTAGTAACATTGGCGCTTGGG + Intergenic
1180883823 22:19225410-19225432 GTGTAGTCACATGGTGGGGTCGG + Intronic
1181223358 22:21376145-21376167 ATGTAGTAACATTGGCGCTTGGG - Intergenic
1181255382 22:21559481-21559503 ATGTAGTAACATTGGCGCTTGGG + Intronic
1181349324 22:22244146-22244168 ATACAGGCACACTGGGGGTTAGG + Intergenic
1181665647 22:24394462-24394484 ATATTATCACATTGGGGATTAGG + Intronic
1181743756 22:24941484-24941506 ATATCATCACCTTGGGGGTTAGG + Intronic
1181899902 22:26145144-26145166 ATACCATCACATTGGGGGTTGGG - Intergenic
1182110880 22:27722476-27722498 ATATAGTCACATTGGAGGTTAGG - Intergenic
1182233252 22:28855046-28855068 ATCCAGTCATGTTGGGGGTTGGG + Intergenic
1182400443 22:30072259-30072281 GTATAGTAACATTGGAGGTTAGG - Intergenic
1182493310 22:30688713-30688735 ATACAGTCACACTGGGGGTTAGG + Intergenic
1183011409 22:34949937-34949959 ATACAGCCTCATTGGGGGTTAGG - Intergenic
1183046243 22:35222765-35222787 ATACAGTCACATTAGGGGTCAGG - Intergenic
1183278745 22:36920341-36920363 ATATTCTCACATTGGGGATTAGG - Intronic
1184526602 22:45027568-45027590 AAACAGTCACATTGAGGGTTGGG - Intergenic
1184543673 22:45150207-45150229 ATGAAGTCACACTGGGGATTAGG - Intergenic
1184977246 22:48071079-48071101 GTGTGTTCTCATTGGGGGTTAGG + Intergenic
1185022770 22:48389747-48389769 ATACAGACACATTGGGAGTTGGG - Intergenic
949185827 3:1190298-1190320 ATACCGTCACATCGGGGGTTAGG + Intronic
949525231 3:4896720-4896742 ATATCATCACCTTGGGGGTTAGG + Intergenic
949582083 3:5398582-5398604 ACATAGCCACATTGGGGGTGAGG + Intergenic
949730311 3:7104015-7104037 ATGTCTTCACATTGGGGTTTAGG - Intronic
949769189 3:7560018-7560040 ATACAGTCATATTGGGGGTTAGG + Intronic
949791167 3:7793633-7793655 ATCTAGTCACATTGCGGGTTAGG - Intergenic
949798027 3:7872243-7872265 ATACAGTCACATTGGGGATTGGG - Intergenic
949931460 3:9081886-9081908 ATACCATCACATTGGGGGTTAGG - Intronic
949932304 3:9088562-9088584 TGGTTGTCACACTGGGGGTTGGG - Intronic
950459269 3:13111602-13111624 ATACTGTCACATTGGGGGTTAGG - Intergenic
950766047 3:15273873-15273895 ATATAATCACATTAGGGATTAGG - Intronic
950885544 3:16359368-16359390 ATATAGTCACATTGTGGGTTAGG - Intronic
950899741 3:16486810-16486832 ATGTAGTCACTTTAGGGGTTAGG - Intronic
950948795 3:16978027-16978049 ATATTATCACATTGGGGATTAGG + Intronic
951467556 3:23018818-23018840 ATATTGTCACATTGGGTGTTAGG - Intergenic
951473732 3:23082698-23082720 ATATCGTCACATTGGGAGTTAGG - Intergenic
951515245 3:23551860-23551882 ATATAGTCACATTAGGAGTTAGG - Intronic
951805120 3:26635359-26635381 ATACCATCACATTGGGGGTTAGG - Intronic
951952346 3:28214118-28214140 ATATAGTCCCACTGAGGGTTAGG + Intergenic
951955635 3:28250100-28250122 ATACAGTCACATTGAGGGTTAGG + Intronic
951979499 3:28549828-28549850 ATACAGTCACTTTGGGAGTTAGG + Intergenic
952135588 3:30415651-30415673 ATATAGTCATATTTGGGGTTGGG - Intergenic
952235053 3:31470807-31470829 ATACAGTCACACTGGGTGTTAGG + Intergenic
952260924 3:31739445-31739467 ATATGGTCACATTGGGGTTTAGG - Intronic
952290427 3:32009976-32009998 ATACAGTCACATTGGGAGTTAGG - Intronic
952434271 3:33256763-33256785 ATATCATCACCTTGGGGGTTAGG - Intergenic
952509795 3:34041710-34041732 ATATCATCACATTGGGGGTTAGG - Intergenic
952569140 3:34693498-34693520 ATACAGTCACATTGAGGGTTAGG - Intergenic
952585672 3:34889094-34889116 ATACCATCACATTGGGGGTTAGG + Intergenic
952585870 3:34891244-34891266 AAACAGTCACATTGGGGGTTAGG + Intergenic
952760024 3:36905323-36905345 ATATTGTCACATTGAGGGGTAGG - Intronic
952810487 3:37398149-37398171 ATACAGTCACATTGGGAGCTAGG + Intronic
952943980 3:38464094-38464116 CAATAGTCACATTGGAGGTTAGG + Intronic
953045337 3:39289685-39289707 ATATAGTCATATTGTGGGTTAGG - Intergenic
953249836 3:41234961-41234983 ATGTACTCATATTGGGGCTTTGG + Intronic
953298478 3:41747578-41747600 ATATAGTCACATTGAGGGTTAGG - Intronic
953358080 3:42271216-42271238 ATACCATCACATTGGGGGTTAGG + Intergenic
953538850 3:43796595-43796617 ATATAGTCACATTGTGGGTTAGG - Intergenic
953592177 3:44268782-44268804 ATATAGTCATATTGAGGGTTAGG + Intronic
953769329 3:45766585-45766607 ATACAGTCACATTGGGAGCTAGG - Intronic
954091966 3:48292103-48292125 ATATCATCACATTGGGGGTTAGG + Intronic
954339956 3:49945525-49945547 ATACAGTCACACTGGGGCTTAGG - Intronic
955163712 3:56490124-56490146 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
955455572 3:59117487-59117509 ATATAGTCACATTGGGGTTAGGG - Intergenic
955646165 3:61139410-61139432 ATTCCATCACATTGGGGGTTAGG - Intronic
955873646 3:63466867-63466889 ATACAGACACACTGGGGGTTGGG + Intronic
955888774 3:63628415-63628437 ACACAGTCACATTGAGGGTTAGG - Intergenic
955998221 3:64700185-64700207 ATGGAGTCACGTTGGGAGTTAGG + Intergenic
956144689 3:66180827-66180849 ATACAGTCACACTGGGGGTTAGG - Intronic
956225314 3:66950805-66950827 ATATCATCACATTGGGGCTTAGG + Intergenic
956230963 3:67016166-67016188 ATACCATCACATTGGGGGTTAGG + Intergenic
956389611 3:68757378-68757400 ATATAATCACATTTGGGGTTAGG + Intronic
956794896 3:72709032-72709054 ATGCAGTCACATTGGGGGTTAGG - Intergenic
956863563 3:73347966-73347988 ATACAGTCACATTGGGGTTAGGG + Intergenic
957217715 3:77343172-77343194 ATACAGTCACATTGGGGGTTAGG + Intronic
957239154 3:77636112-77636134 ATATCATCACATTGGGGATTAGG + Intronic
957286092 3:78219199-78219221 ATATAGTCACATTGGAAGTTTGG + Intergenic
957313766 3:78551598-78551620 ATACAGTCACATTGAGGGTTAGG - Intergenic
957432077 3:80123739-80123761 ATACAGTCATATTGGGGGTTAGG + Intergenic
957520101 3:81308382-81308404 ATACCATCACATTGGGGGTTAGG - Intergenic
957612243 3:82483264-82483286 ATATAATCATATTGGGGCTTAGG - Intergenic
957782373 3:84835600-84835622 ATATAGTCACATTAAAGGTTAGG + Intergenic
957839152 3:85643912-85643934 ATACAGCTACATTGGGGGTTAGG + Intronic
957883267 3:86249521-86249543 ATGTTATCACATTGGGGATTAGG - Intergenic
957997393 3:87707749-87707771 ATATGGTTACATTGGGAGTTAGG + Intergenic
958187011 3:90134982-90135004 ATACAGTCACACTGGGGCTTAGG - Intergenic
958415179 3:93865405-93865427 ATGTAGTCACTTTGGAGTTTAGG + Intergenic
958421430 3:93936131-93936153 ATATAGCCACACTGGGTGTTAGG - Intronic
958626610 3:96633162-96633184 ATGTCATCACATTGGGGACTGGG - Intergenic
958856114 3:99387813-99387835 ATACAATCACATTGAGGGTTAGG - Intergenic
958925592 3:100153695-100153717 ATATAGTGGCATTGGGGGTTAGG + Intronic
959061460 3:101619998-101620020 ATTAAATCACCTTGGGGGTTAGG + Intergenic
959101608 3:102016736-102016758 GTGCAGTCACACTGGTGGTTAGG + Intergenic
959219603 3:103499954-103499976 GTTTAGTCATATTTGGGGTTTGG + Intergenic
959495724 3:107049028-107049050 AAATAGTCACATTGGGGTTTGGG + Intergenic
959608107 3:108264012-108264034 ATACAGTCACACTGGGTGTTGGG + Intergenic
959638165 3:108599659-108599681 ATACTATCACATTGGGGGTTAGG - Intronic
959712991 3:109403289-109403311 ATGGGATCACATTGGGGGTTAGG + Intergenic
959877027 3:111395251-111395273 ATGTAATCACATTAGAGATTAGG - Intronic
959910615 3:111759420-111759442 ATGCTGTCACATTGGTGATTAGG + Intronic
959915353 3:111810632-111810654 ATACAGTCATATTGAGGGTTAGG + Intronic
960035837 3:113102339-113102361 ATGTAATCACATTGAGAGTTAGG + Intergenic
960463034 3:117960197-117960219 ATGCCGTCACATTTGGGATTAGG - Intergenic
960703086 3:120456074-120456096 GAACAGTCACATTGGGGGTTCGG + Intergenic
960724439 3:120655999-120656021 ACATAGTCACATTGAAGGTTAGG - Intronic
960953518 3:123014915-123014937 ATGAAGTCACACTGGAGGGTGGG + Intronic
962353067 3:134669887-134669909 ATATCATCACATTGGGGATTAGG - Intronic
962577469 3:136768034-136768056 ATATAATCACATTGGGGACTAGG - Intergenic
962587782 3:136860181-136860203 ATATAGTCACATTAGGAGTGAGG + Intergenic
962682050 3:137810510-137810532 ATACAGTCACACTGGGGTTTAGG - Intergenic
962685423 3:137843046-137843068 ATATCATCACATTGGGGGTTAGG - Intergenic
962687374 3:137860553-137860575 ATGCCATCACATTGGGGATTAGG - Intergenic
962815408 3:138992841-138992863 ATACCATCACATTGGGGGTTAGG - Intergenic
962853665 3:139326123-139326145 ATACAGCCACATTGGGTGTTAGG - Intronic
963118284 3:141752787-141752809 ATATAATCACATTGGGGGTTAGG - Intergenic
963448772 3:145449664-145449686 ATATAGCCACATTGGGAGTTAGG + Intergenic
963474083 3:145781054-145781076 ATGTAGTCACATTGAGTGTTAGG + Intergenic
963526727 3:146424373-146424395 ATACAGTCACATTGCGGGTTTGG + Intronic
963654584 3:148029554-148029576 ATATAGTAACTTTGGGGGCTAGG + Intergenic
963773958 3:149419954-149419976 TTACAGTCACAGTGGGGGTTAGG - Intergenic
963877907 3:150497472-150497494 ATACAGTCACATTGGGGGTTAGG - Intergenic
963907225 3:150782685-150782707 ATACTATCACATTGGGGGTTAGG - Intergenic
964034286 3:152177229-152177251 ATATAGTCACATTGGTGGTTAGG + Intergenic
964155102 3:153575696-153575718 ATGTCATCACTTTGAGGGTTAGG + Intergenic
964274738 3:154997745-154997767 ATACAGTCACATTGAGAGTTAGG + Intergenic
964280884 3:155063885-155063907 ATACAGTCACATTGAGAGTTAGG - Intronic
964369120 3:155981179-155981201 ATACAATCACATTGGGAGTTAGG + Intergenic
964639307 3:158891672-158891694 ATACTGTCACATTGGGGATTAGG + Intergenic
964809922 3:160652472-160652494 ATACAGTCACGTGGGGGGTTAGG - Intergenic
964858563 3:161173866-161173888 ATATAGTCACATTTCGGGTTAGG + Intronic
964918878 3:161871744-161871766 ATACCATCACATTGGGGGTTAGG - Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
965708968 3:171537300-171537322 ATACAGTCACACTGGGGGTCAGG + Intergenic
965836885 3:172862746-172862768 ATATAGTCAGATTGGGGGTTAGG - Intergenic
965936792 3:174123958-174123980 ATAGAGTCACACTGGAGGTTAGG - Intronic
965985990 3:174753788-174753810 GTGCAATCACACTGGGGGTTAGG - Intronic
966082853 3:176026169-176026191 ATACAGTCACATTGGGGGTTAGG + Intergenic
966104097 3:176314121-176314143 ATATGGTCACATTGAGAGTTGGG + Intergenic
966119072 3:176502200-176502222 ATATCATCACATTGGGGGTTAGG + Intergenic
966535879 3:181033088-181033110 ATACAGTCATATTGGGGATTAGG + Intergenic
966647492 3:182262899-182262921 ATATCATCACCTTGGGGGTTAGG - Intergenic
966774504 3:183532087-183532109 ATACATTCACATTAGGGGTTAGG - Intronic
966793037 3:183690833-183690855 ATACTGTCACATTGGGGATTAGG + Intergenic
966894946 3:184437450-184437472 TTGTAGTTACCTTGGGGCTTAGG + Intronic
967093761 3:186159778-186159800 ATATAGTCACACTGGGGGTTAGG - Intronic
967259180 3:187625304-187625326 ATGCCATCACCTTGGGGGTTGGG - Intergenic
967502670 3:190217996-190218018 ATACAGTCACATTGGGAATTAGG + Intergenic
967715200 3:192754405-192754427 ATGTAGTCAGACTTGGGGATTGG - Intronic
968527247 4:1067167-1067189 ATATAGTCACATTGGAGGTTAGG + Intronic
968571375 4:1343383-1343405 ATAAAGTCACATTGGAGGTTAGG + Intergenic
969152474 4:5181196-5181218 ATACAGTGACATTGGGGGCTAGG - Intronic
969288585 4:6223751-6223773 ATACAGCCATATTGGGGGTTAGG + Intergenic
969331498 4:6475843-6475865 ACATCATCACATTGGGGGTTAGG - Intronic
969385203 4:6840374-6840396 ATGCAGACACATTGTGGTTTTGG + Intronic
969630304 4:8332132-8332154 ATGCAATCCCATTGTGGGTTAGG - Intergenic
969854956 4:9991606-9991628 ATGCAGTCACATTAGGGGTTAGG - Intronic
970460886 4:16273670-16273692 ATACAGTCACATTGGAGGATGGG + Intergenic
970482936 4:16496034-16496056 ATATAATCACATTGGGGATCAGG - Intergenic
970680696 4:18504259-18504281 ATGTCATCAACTTGGGGGTTAGG - Intergenic
970770546 4:19607038-19607060 ATACAGTCACATTGGGGGTTAGG + Intergenic
970793135 4:19882617-19882639 ATATAGTCACATTGGGGATTAGG + Intergenic
970866270 4:20762316-20762338 ATACTATCACATTGGGGGTTAGG + Intronic
970897799 4:21123682-21123704 GTATCATCACATTGGGGGTTAGG - Intronic
971145947 4:23976567-23976589 ATATAGTCACATTAGGGATTAGG - Intergenic
971431385 4:26571752-26571774 CAATAGTCATATTGGGGGTTGGG - Intergenic
971447371 4:26765412-26765434 ATGAACTCATATTGGGGGCTGGG + Intergenic
971637447 4:29079616-29079638 ATATAGTCACATTGGGTGATAGG + Intergenic
971795527 4:31222163-31222185 ATACAGTCACAGTGGAGGTTAGG + Intergenic
971822820 4:31580813-31580835 AGGTTATCACATTGAGGGTTAGG - Intergenic
971826168 4:31625960-31625982 ATGCAGTCATATTTGGAGTTAGG - Intergenic
971982372 4:33769214-33769236 ATACCATCACATTGGGGGTTAGG - Intergenic
971996446 4:33971764-33971786 ATACAGTCCCATTGGAGGTTAGG - Intergenic
972028966 4:34428198-34428220 ATGCAGTCACATTGAGTATTAGG + Intergenic
972057552 4:34823433-34823455 ATGCAGTCACATTGGAGGTTAGG + Intergenic
972220262 4:36947340-36947362 ATATAGTCACATTGGGGGTTTGG - Intergenic
972262338 4:37422081-37422103 ATGCAGTCACATGGGTAGTTAGG + Intronic
972413102 4:38812617-38812639 ATATTATCACATTGAGGGTTGGG - Intronic
972533702 4:39982156-39982178 CTGTAGTGAAATTGGGGGTTAGG - Intergenic
972638739 4:40907219-40907241 ATACAGTCACATTGGGGGTTAGG - Intronic
972803718 4:42506059-42506081 ATGTAGTGTCACTGGCGGTTAGG - Intronic
972845946 4:42989422-42989444 ATATAGTTACATTGAGTGTTAGG + Intronic
972853332 4:43075704-43075726 ATATCATCACATTGGGGATTAGG + Intergenic
972856266 4:43111130-43111152 ATATAATCACACTGGGAGTTAGG - Intergenic
972936373 4:44140942-44140964 ATATTGTCACACTGGGGATTAGG + Intergenic
973006106 4:45008653-45008675 ATATAGTCACATTAGCAGTTAGG - Intergenic
973163936 4:47053528-47053550 ATGCCATCACATTGAGGGTTAGG + Intronic
973766370 4:54166902-54166924 CTGTTATCACATTGGGTGTTAGG + Intronic
973940532 4:55905536-55905558 ATACAGCCACATGGGGGGTTAGG - Intergenic
973962269 4:56123531-56123553 ATACAGTCACGTTGAGGGTTAGG + Intergenic
974013764 4:56630411-56630433 ATACTATCACATTGGGGGTTAGG + Intergenic
974031983 4:56784452-56784474 ATGCCATCACATTGAGGGTTAGG - Intergenic
974095759 4:57362098-57362120 ATGCAGCCACATTGGAGGTTAGG + Intergenic
974400864 4:61403998-61404020 ATACAGTCACTTTGGGGTTTAGG + Intronic
974415912 4:61606640-61606662 ATATAGTCACATTGGAGGTTAGG + Intronic
974586280 4:63882937-63882959 ATGCCATTACATTGGGGGTTTGG - Intergenic
974921023 4:68239115-68239137 ATACAGTCACATTGGTGTTTAGG - Intronic
974930813 4:68359004-68359026 ATATAGTCATATTGGGGAATAGG - Intergenic
975357869 4:73429433-73429455 GTGTCATCACATTGGGGGTTAGG + Intergenic
975455182 4:74582127-74582149 ATATGATCACATTGGGGATTAGG - Intergenic
975684266 4:76904256-76904278 ATACCATCACATTGGGGGTTAGG - Intergenic
975706823 4:77120173-77120195 ATATCATCATATTGGGGGTTAGG - Intergenic
975813198 4:78190840-78190862 ATATACTCACATTGGATGTTAGG - Intronic
975929231 4:79498220-79498242 AAGTTATCACATTGGGGATTAGG + Intergenic
975937662 4:79600965-79600987 GTGAAATCACATTGGGGATTAGG + Intergenic
976248553 4:83027532-83027554 ATAATGCCACATTGGGGGTTAGG - Intergenic
976324811 4:83759138-83759160 ATACAGTGACATTGAGGGTTAGG - Intergenic
976597114 4:86904889-86904911 ATATAATTACATTAGGGGTTAGG - Intronic
976713803 4:88101590-88101612 ATACCATCACATTGGGGGTTGGG - Intronic
976736627 4:88316888-88316910 ATACCATCACATTGGGGGTTAGG - Intergenic
976783083 4:88783672-88783694 ATATGGTCACATTGGGGGTTAGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
976854219 4:89583548-89583570 ATACAGTGACCTTGGGGGTTAGG - Intergenic
976936965 4:90648510-90648532 ATACAGTCACATTGGTGGTTAGG - Intronic
977242827 4:94593669-94593691 AAATAGTCACATTGTGGGTTAGG + Intronic
977448509 4:97163028-97163050 ATACTATCACATTGGGGGTTAGG - Intergenic
978014778 4:103729427-103729449 ATGCAGTGACATTGGGAGATGGG - Intergenic
978109595 4:104946955-104946977 ATGTCATCACCTTGGGGATTAGG - Intergenic
978161788 4:105557504-105557526 ATACTGTCACATTGGGGATTAGG - Intronic
978178530 4:105764722-105764744 ATATAGTCATGTTGGAGGTTAGG + Intronic
978199076 4:106004168-106004190 ACACAGTCACATTTGGGGTTAGG - Intergenic
978258706 4:106723906-106723928 ATATAGTCACATTGAAGTTTAGG + Intergenic
978480577 4:109185627-109185649 ATACAGCCACACTGGGGGTTAGG - Intronic
978502923 4:109428278-109428300 ATATAGTTACATGTGGGGTTAGG - Intergenic
978556929 4:109990939-109990961 ATACAGTCACTTTGGGAGTTAGG + Intronic
978968163 4:114768455-114768477 ATATAGATACATTGGGGGTTAGG - Intergenic
979393999 4:120163899-120163921 ATACAGTCATATTGGGGGTTAGG - Intergenic
979480501 4:121210825-121210847 ATGCAGTCACATTGGGGTTTAGG + Intronic
979672083 4:123370744-123370766 ATACAGTCATATTGGGGGTTAGG - Intergenic
979704297 4:123703272-123703294 ATACAGTCATATTGGGGGTTAGG - Intergenic
979784035 4:124692548-124692570 ATACCATCACATTGGGGGTTAGG - Intronic
979975780 4:127194625-127194647 ATGCAATCTCATTGGGGGTTAGG + Intergenic
979987142 4:127329261-127329283 ATATATTTACATTGGAGGTTAGG - Intergenic
980093182 4:128463299-128463321 ATACAGTCACCTTGGGGGTTGGG + Intergenic
980403900 4:132331475-132331497 ATATATTTACATTGGGGGGTAGG - Intergenic
980440095 4:132831299-132831321 ATACAATCATATTGGGGGTTAGG + Intergenic
980560442 4:134465722-134465744 ATACAGTCACATTGGAAGTTAGG + Intergenic
980899149 4:138887894-138887916 ATGCCATCACATTGGGGATTAGG - Intergenic
981028759 4:140102628-140102650 ATACAGTCACATTGAGGATTAGG + Intronic
981046083 4:140266535-140266557 ATGCCATCACATTGGGGATTAGG + Intronic
981305891 4:143246797-143246819 ATATAGTCACATTAGGGGTTAGG + Intergenic
981451732 4:144906147-144906169 ATATCATCACATTGGGGGTTAGG - Intergenic
981498877 4:145425042-145425064 ATACAGCCACATTGGGGTTTAGG - Intergenic
981670079 4:147276624-147276646 ATACTGTCACATTGAGGGTTAGG + Intergenic
981872551 4:149504523-149504545 ATATGGTAACATTGTGGGTTAGG - Intergenic
981903867 4:149896923-149896945 ATATCATCACTTTGGGGGTTAGG - Intergenic
982126014 4:152184586-152184608 ATACCGTCACCTTGGGGGTTAGG - Intergenic
982228173 4:153184468-153184490 ATACAGCCACATTGGGGGCTAGG + Intronic
982237356 4:153263948-153263970 ATCCCATCACATTGGGGGTTAGG + Intronic
982558321 4:156898052-156898074 ATGCCATCACATTGGGGATTAGG - Intronic
982618128 4:157667759-157667781 ATATCATCACATTGGGGGTTAGG + Intergenic
982768031 4:159369791-159369813 ATGCAGTCACATTGGGAGTTAGG + Intergenic
982951169 4:161698016-161698038 ATGCCATCACATTGGGGGTTAGG - Intronic
982954960 4:161752754-161752776 ATATAGTCACATTGAGGGTTAGG - Intronic
982996384 4:162353055-162353077 ATACCATCACATTGGGGGTTAGG + Intergenic
983142215 4:164165223-164165245 ATATAGTCACATTGGGGGTTGGG - Intronic
983355697 4:166654779-166654801 ATTAAGTCACATTTGGGTTTTGG - Intergenic
983367228 4:166808327-166808349 ATACAGTCACATTGGCAGTTAGG - Intronic
983550849 4:169015933-169015955 ATACAGCCACATTGGAGGTTAGG - Intergenic
983672300 4:170252400-170252422 ATACCATCACATTGGGGGTTAGG - Intergenic
983852228 4:172595149-172595171 ATATCATCACATTGGAGGTTAGG + Intronic
984085257 4:175302389-175302411 ATACAGTCACATTGGGATTTGGG - Intergenic
984090735 4:175371543-175371565 ATACAGTCACATTAGGTGTTAGG + Intergenic
984289961 4:177782214-177782236 ATTTCATCACATTGTGGGTTAGG + Intronic
984739070 4:183141438-183141460 ATATATTCACATTGGGAATTAGG + Intronic
984867586 4:184295207-184295229 AAGTCATCACATTGAGGGTTAGG + Intergenic
985130340 4:186732694-186732716 ATACAGTCACATTGAGGGTTAGG + Intergenic
985562514 5:596694-596716 ATACAGTTACATTGGGGGTTAGG + Intergenic
985771563 5:1815040-1815062 ATACAGTCACATCGGGGGTTAGG + Intronic
985847274 5:2359764-2359786 GTGTAGTCATATTGGGGAATTGG + Intergenic
986306919 5:6522963-6522985 CTACAGTCACACTGGGGGTTGGG + Intergenic
986376227 5:7134755-7134777 ATATCATCACATTGGGAGTTAGG - Intergenic
986482715 5:8204869-8204891 ATGCCATTACATTGGGGGTTAGG + Intergenic
986647396 5:9930705-9930727 ATACAGTCACACTAGGGGTTAGG + Intergenic
986713307 5:10503268-10503290 ATACAGTCACATTGGGGGTTAGG + Intergenic
986762270 5:10891108-10891130 ATGCAGTGACATTGGAAGTTAGG - Intergenic
987107711 5:14656780-14656802 ATATAGTCACATTGGGGGTTAGG + Intergenic
987175361 5:15302540-15302562 ATGCCATCACATTGGAGGTTTGG - Intergenic
987208867 5:15658116-15658138 ATGGAATGACACTGGGGGTTTGG + Intronic
987225679 5:15838463-15838485 ATGCCATAACATTGGGGGTTAGG + Intronic
987263756 5:16229744-16229766 ATTCAGTCACATTGGAGATTAGG - Intergenic
987345493 5:16975312-16975334 ATGTCATCACATTTGGGGTTAGG - Intergenic
987387409 5:17343018-17343040 GTATCATCACATTGGGGGTTAGG + Intergenic
987795025 5:22616770-22616792 ATACCATCACATTGGGGGTTAGG - Intronic
987820625 5:22961617-22961639 ATATAGTCACATTGGAATTTAGG + Intergenic
987854946 5:23409035-23409057 ATACAGTCGTATTGGGGGTTAGG - Intergenic
987963726 5:24845484-24845506 ATACAGTCACATTGAGGGTTAGG - Intergenic
988314853 5:29611143-29611165 GTACAGTCACAATGGGGGTTAGG + Intergenic
988329029 5:29810990-29811012 ATACAGACACATTGGGGGTTAGG - Intergenic
988428759 5:31094186-31094208 ATACCATCACATTGGGGGTTAGG + Intergenic
988488545 5:31687903-31687925 GTGCAGTCACATGGTGGGTTAGG + Intronic
988634685 5:32970138-32970160 ATACAATCACATTGGGGATTAGG + Intergenic
988713166 5:33798832-33798854 ATATAGTCACATTGGGGGTTAGG + Intronic
988858153 5:35249181-35249203 ATATTGTCACATTGAGTGTTAGG + Intergenic
988993666 5:36694336-36694358 ATATAGTCACATTGGGGGTTAGG - Intergenic
989066460 5:37467497-37467519 ATATCCTCACTTTGGGGGTTAGG + Intronic
989369820 5:40694716-40694738 ATATAGTCACAATGAGGGTTAGG + Intergenic
989526540 5:42459978-42460000 ATTCAGCCACATTGGAGGTTAGG - Intronic
989777763 5:45229990-45230012 ATATCATCACCTTGGGGGTTAGG - Intergenic
990167255 5:53008402-53008424 ATACAATCACATTGAGGGTTAGG + Intronic
990182219 5:53174045-53174067 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
990236040 5:53768546-53768568 ATATAGTCACATTGGGAGTTAGG + Intergenic
990266362 5:54081086-54081108 ATATAGTCATGTTGGGTGTTAGG + Intronic
990320057 5:54620973-54620995 ATCCATTCACATTAGGGGTTAGG + Intergenic
990389189 5:55301140-55301162 ATATAGCCACACTGGGGGTAAGG + Intronic
990459718 5:56020013-56020035 ATACAGTCACGTTGGGAGTTAGG - Intergenic
990460823 5:56029422-56029444 ATACAGCCACACTGGGGGTTAGG - Intergenic
990558231 5:56957656-56957678 ATATAGCCACACTGGGGGTTAGG - Intronic
990564265 5:57013348-57013370 ATACAGTCACATTGAGTGTTAGG - Intergenic
991032093 5:62093057-62093079 ATTTAGTCACATGGAGGATTTGG - Intergenic
991088153 5:62667296-62667318 ATACAGTCACATTGGAGGTTAGG + Intergenic
991183155 5:63777911-63777933 ATATAGTGACATGGAGGGTTAGG + Intergenic
992095832 5:73361649-73361671 ATATAATCACATTGAGGATTAGG + Intergenic
992110598 5:73488936-73488958 ATACAGTCACATTGAGGGTTAGG + Intergenic
992200224 5:74376301-74376323 ATACAGTCACATTGGGGGTTAGG - Intergenic
992210156 5:74471370-74471392 AAATAGTCACATTGAGGGTTAGG - Intergenic
992284800 5:75223733-75223755 ATATCATCACATTGGCGGTTAGG - Intronic
992486512 5:77202109-77202131 ATATAGCCACACTGGGGGTTAGG + Intergenic
992943500 5:81786525-81786547 ATACAATCACCTTGGGGGTTAGG + Intergenic
993195423 5:84736631-84736653 ATATAGTCACATTGGGTGTTAGG + Intergenic
993231156 5:85238345-85238367 ATGCAGTGACATTAGGAGTTAGG - Intergenic
993549672 5:89258219-89258241 ATATAGTCACATGGCGAGTTAGG + Intergenic
993550384 5:89266514-89266536 ATACAGCCACACTGGGGGTTAGG - Intergenic
993572808 5:89563280-89563302 ATACCATCACATTGGGGGTTAGG + Intergenic
993631395 5:90290147-90290169 ACACAGTCACATTAGGGGTTAGG + Intergenic
993769210 5:91904058-91904080 ATGCCATCACATTGGGGATTAGG - Intergenic
993815410 5:92538716-92538738 ATATAGACACATTGGGGATTAGG - Intergenic
994052918 5:95382486-95382508 ATATCTCCACATTGGGGGTTAGG + Intergenic
994242422 5:97440178-97440200 AAATAGTCATATTGGGGGTTAGG + Intergenic
994420006 5:99520043-99520065 ATATCCTCACCTTGGGGGTTAGG + Intergenic
994465134 5:100117599-100117621 ACCTAGTCACATTGGAGGTTAGG - Intergenic
994487204 5:100395099-100395121 ATATCCTCACCTTGGGGGTTAGG - Intergenic
994665984 5:102705761-102705783 CTACATTCACATTGGGGGTTAGG + Intergenic
994717412 5:103338377-103338399 ATGCTGTCACAATGGGGGTCAGG - Intergenic
994719662 5:103366157-103366179 ATATGATCACATTGGTGGTTAGG + Intergenic
994876547 5:105430538-105430560 ACACAGTGACATTGGGGGTTAGG - Intergenic
995027327 5:107439093-107439115 ATGCAATCACATTGTGGGTTGGG - Intronic
995128792 5:108608129-108608151 ATGTTGTCACATTTTGGGTTAGG - Intergenic
995285654 5:110385559-110385581 ATACTGTCACATTGGGGATTAGG - Intronic
995558527 5:113355807-113355829 ATGCCATCACACTGGGGGTTAGG + Intronic
995855763 5:116590488-116590510 ATGCAGCCATACTGGGGGTTAGG - Intergenic
995921646 5:117321741-117321763 ATATTGTCACATTGGGGATTAGG - Intergenic
996081204 5:119260300-119260322 ATACAGTCACAGTGGGGCTTAGG - Intergenic
996164484 5:120208560-120208582 ATGTAGTCACACTGGGAACTAGG - Intergenic
996261606 5:121477582-121477604 ATACAGTCACATTGGGAGTTAGG + Intergenic
996485362 5:124027345-124027367 ATGCCATCACATTGGGGGTTAGG - Intergenic
996488108 5:124060090-124060112 ATACAGTCACATTGGGGGTTGGG + Intergenic
996503105 5:124238411-124238433 ATATCATCACATTGTGGGTTAGG + Intergenic
996506767 5:124276566-124276588 ATACCGTCACACTGGGGGTTAGG + Intergenic
996872189 5:128203729-128203751 ATATAGTCACATTGGGGATTAGG - Intergenic
997806874 5:136926942-136926964 ATACAGTCATATTGGGGGTTAGG - Intergenic
998452338 5:142244666-142244688 ATACAGTCACATTGGGGGTTAGG + Intergenic
998524762 5:142832244-142832266 AAGTAGTTATATTGGGAGTTAGG - Intronic
998626049 5:143847169-143847191 ATAGAGCCACATTGTGGGTTGGG - Intergenic
998640358 5:144003477-144003499 ATATCATCACATTGGGGATTAGG + Intergenic
998918648 5:147043275-147043297 ATGCAGCCACATTGGGGGTTGGG - Intronic
998986396 5:147762685-147762707 ATGCAGTCACATTGAAGATTAGG + Intronic
999066048 5:148686610-148686632 ATATAGTTACATTAGGAGTTAGG - Intergenic
999130107 5:149275905-149275927 ATACAGTCACACTTGGGGTTAGG + Intronic
999461294 5:151759194-151759216 ATACAGTCGCATTGGGGGTTAGG + Intronic
999473461 5:151876801-151876823 ATATAGTCACTCTGGGGGTTAGG - Intronic
999509415 5:152232670-152232692 ATACAATCATATTGGGGGTTAGG + Intergenic
999592929 5:153168504-153168526 ATATAGTCACATTGGAATTTAGG + Intergenic
999698874 5:154209730-154209752 ATACCGTCACCTTGGGGGTTAGG + Intronic
999840363 5:155418502-155418524 ATACAGTCACATTAAGGGTTAGG + Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000067124 5:157704181-157704203 ATACAGCCACACTGGGGGTTAGG - Intergenic
1000097563 5:157985208-157985230 ATACAGTCACATTGGGGATTAGG - Intergenic
1000131358 5:158303242-158303264 ATACCATCACATTGGGGGTTAGG + Intergenic
1000528487 5:162388386-162388408 ATATGGTCACATTGATGGTTGGG + Intergenic
1000609017 5:163355308-163355330 ATATTGTTACATTGGGGGTTAGG - Intergenic
1000662729 5:163956246-163956268 ATAGAGTCATATTGGGGGTTAGG - Intergenic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1000921020 5:167137180-167137202 ATATTATCACATTGGGGGATAGG + Intergenic
1001065744 5:168533814-168533836 ATATAGTAACACTGGGGATTGGG + Intergenic
1001186647 5:169580307-169580329 ATACAGTCACATTGGGAATTAGG + Intergenic
1001277809 5:170363322-170363344 ATACAGCCACCTTGGGGGTTAGG - Intronic
1001836997 5:174841125-174841147 ATCCCATCACATTGGGGGTTAGG - Intergenic
1002114940 5:176952961-176952983 ATATTATCACATTAGGGGTTGGG - Intronic
1002317377 5:178351771-178351793 ATATAGTCACAATGGGGACTAGG - Intronic
1002458261 5:179358445-179358467 ATACAGTCCCATTAGGGGTTAGG - Intergenic
1003621433 6:7704531-7704553 ATATTATCACCTTGGGGGTTAGG - Intergenic
1003690597 6:8349992-8350014 ATACAGTCACATTGGAGGCTGGG + Intergenic
1003948668 6:11097702-11097724 GTACAGTCACACTGGGGGTTAGG + Intronic
1004026522 6:11824513-11824535 ATACAGTCACATCGGGAGTTAGG + Intergenic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1004043497 6:12005940-12005962 ATACAGTAACATTGGGGGTTAGG - Intergenic
1004300647 6:14454275-14454297 ATATAGTCATATTGGGGGGGGGG + Intergenic
1004429481 6:15530943-15530965 ATATCCTCATATTGGGGGTTAGG - Intronic
1004604263 6:17179098-17179120 ATATAGTCACATTGAGGGTTAGG - Intergenic
1004761566 6:18672306-18672328 ACACAGTCACATTGGGGGTTAGG + Intergenic
1004787664 6:18987213-18987235 ATATAGTCACATTGGAGGTTAGG - Intergenic
1004792209 6:19038989-19039011 ATGTCGTCATATTGGGAATTAGG + Intergenic
1004994940 6:21181321-21181343 ATGTGGTTATATTGGGTGTTGGG + Intronic
1005047127 6:21653189-21653211 ATATAGTCACACTGGGGGTTAGG + Intergenic
1005104282 6:22206632-22206654 ATACAATCACATTGGGGGTTAGG - Intergenic
1005106816 6:22232747-22232769 ATACGGTCACATTGAGGGTTAGG - Intergenic
1005190518 6:23216546-23216568 ATATAGTCACATTAGGACTTAGG + Intergenic
1005467557 6:26130248-26130270 ATGCAGTCACACTGGGGTTTAGG + Intronic
1005550006 6:26902575-26902597 ATATCCTCACCTTGGGGGTTAGG - Intergenic
1005660663 6:27995834-27995856 ATATCATCACATTGGGGGTAAGG + Intergenic
1005805635 6:29471946-29471968 ATATTGTCACATTCAGGGTTAGG - Intergenic
1005972480 6:30772197-30772219 ATATAGTCGCATTGAGAGTTAGG + Intergenic
1005980871 6:30835570-30835592 ATATCATCACACTGGGGGTTGGG - Intergenic
1006265813 6:32922501-32922523 ATATAGTCCCATTGGTGGTTAGG - Intergenic
1006585222 6:35106111-35106133 GTATAGTCATATTGGAGGTTAGG - Intergenic
1006837925 6:37010424-37010446 ATACACTTACATTGGGGGTTAGG + Intronic
1007149357 6:39672835-39672857 ATATAGTCACACTGGGGGTTAGG + Intronic
1007222170 6:40287336-40287358 ATACAGTCACATTGGGGGTTAGG - Intergenic
1007645018 6:43373142-43373164 ATAGCATCACATTGGGGGTTAGG - Intergenic
1007859430 6:44892181-44892203 ATATAGTCACATTGGGGGTTAGG - Intronic
1007923615 6:45632802-45632824 ATACAGTCACATTGGGGATTAGG + Intronic
1007964115 6:45987858-45987880 ATACAGTCACATTGAGGATTAGG + Intronic
1008026032 6:46636960-46636982 ATGACATCACCTTGGGGGTTAGG - Intronic
1008205101 6:48645685-48645707 ATACAGTCAAATTGGGAGTTAGG + Intergenic
1008529082 6:52437834-52437856 ATATAGTCACATTGAGGGTTAGG + Intronic
1008668254 6:53738868-53738890 ATGCAATTACCTTGGGGGTTAGG + Intergenic
1008752319 6:54750465-54750487 ATACAGTCACATTGGAAGTTAGG + Intergenic
1008777208 6:55054701-55054723 AGATAGTCACACTGGGGATTAGG + Intergenic
1008853749 6:56055898-56055920 ATATAGTCACATTGGGGGTAAGG + Intergenic
1008868017 6:56238533-56238555 TTGTAGTCACTGTGGTGGTTGGG - Intronic
1009020269 6:57941474-57941496 ATATCCTCACCTTGGGGGTTAGG - Intergenic
1009039871 6:58163104-58163126 ATACAGTCACATTGAAGGTTAGG + Intergenic
1009215761 6:60917952-60917974 ATACAGTCACATTGAAGGTTAGG + Intergenic
1009342157 6:62569567-62569589 ATGTAGTTACAATGGTGGTTGGG - Intergenic
1009436345 6:63622605-63622627 ATACAGTTACATTGGGAGTTAGG + Intergenic
1009496847 6:64359829-64359851 ATACAGTCACATTGGGGATTAGG + Intronic
1009638315 6:66296023-66296045 ACATAGTCCCATTGGGGGCTAGG + Intergenic
1009641133 6:66337966-66337988 ATAAAATCACATTGCGGGTTAGG + Intergenic
1009744562 6:67796635-67796657 ATGCCATCACATTGGTGGTTAGG - Intergenic
1010391462 6:75343003-75343025 ATAAGGTCACATTGGGGATTAGG - Intronic
1010504213 6:76636757-76636779 ATGATGTCCCATTGGGGGTTAGG - Intergenic
1010628326 6:78166720-78166742 ATATCATCACATTGGGGTTTAGG + Intergenic
1010628559 6:78168887-78168909 ATATCATCACATTGGGGTTTGGG - Intergenic
1010650131 6:78444731-78444753 ATATAATCACATTGGGAGTTAGG + Intergenic
1010953687 6:82067000-82067022 ATATAATCACACTGGGGCTTAGG - Intergenic
1011138420 6:84125498-84125520 ATACAGTCACATTAAGGGTTAGG - Intronic
1011284771 6:85711344-85711366 ATATTGCCACATTGGGGGTTAGG - Intergenic
1011324979 6:86140669-86140691 ATGCAGTCATATTGGGGATTAGG + Intergenic
1011408564 6:87041773-87041795 ATGCAGTCACACTGGGGCTTAGG + Intergenic
1011656917 6:89560451-89560473 ATACAGTCACACTGGGGGTGTGG + Intronic
1011828294 6:91336885-91336907 ATACAGTCACATTGGAGATTAGG + Intergenic
1011979005 6:93347787-93347809 ATACAGTTACATTGGGGGTTAGG + Intronic
1012012074 6:93801453-93801475 ATGCAGCCACACTGGGAGTTGGG + Intergenic
1012043956 6:94245362-94245384 ATGTCATCATATTGGGGATTAGG + Intergenic
1012236861 6:96828376-96828398 ATATAGTCATATTGGGGATTAGG + Intronic
1012311065 6:97724513-97724535 ATATAGTCACATTAGGGGTTAGG - Intergenic
1012785272 6:103617289-103617311 ATACCATCACATTGGGGGTTAGG - Intergenic
1013340113 6:109205677-109205699 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1013448230 6:110252488-110252510 ATACAGTCACACTGGGAGTTAGG + Intronic
1013487101 6:110607452-110607474 ATATAGACGCATGGGGGGTTAGG + Intergenic
1013607650 6:111765249-111765271 ATACAGTTACATTGGGGGTTAGG - Intronic
1013626757 6:111945542-111945564 ATGCCATCACATTAGGGGTTAGG + Intergenic
1013655152 6:112238963-112238985 ATACAGTCACATTAGGGGTTAGG - Intronic
1013977969 6:116098571-116098593 ATATAAACACATTGTGGGTTAGG + Intergenic
1014000647 6:116362398-116362420 ATATGGTCACATTGGGGGTTGGG - Intronic
1014121848 6:117734941-117734963 ATACAGTCACATTTGGGATTAGG + Intergenic
1014253328 6:119137514-119137536 ATACAGTCACATTGGGGGTTAGG + Intronic
1014317423 6:119884785-119884807 ATACAGTCACATTGAGGGTTAGG - Intergenic
1014325207 6:119985492-119985514 AGACAGTCACATTGGTGGTTAGG + Intergenic
1014356280 6:120414261-120414283 ATACAGTCACATTGCGGGTTAGG + Intergenic
1014394020 6:120901852-120901874 ATGCCATCACATTGGGGATTAGG - Intergenic
1014403724 6:121022960-121022982 ATATAGTTGCTTTGGGGGTTAGG - Intergenic
1014553566 6:122817709-122817731 ATGGAGTCACATTGTGGGTCAGG + Intergenic
1014635540 6:123842492-123842514 ATATAGTCTTGTTGGGGGTTAGG + Intronic
1014644482 6:123956302-123956324 ATACAGTCACATTGGAAGTTAGG - Intronic
1014666944 6:124250001-124250023 ATGTCCTCACATTGGAGATTGGG - Intronic
1014722018 6:124928465-124928487 ATTTCATCACATTGGGGGATGGG - Intergenic
1014823815 6:126024633-126024655 ATACAGTCATATTGAGGGTTAGG + Intronic
1015022277 6:128490998-128491020 ATACAATCACATTGGGGGTTAGG + Intronic
1015222005 6:130814598-130814620 ATACAGTCACATTGTGAGTTAGG - Intergenic
1015343238 6:132126521-132126543 ATATCATCACATTGGGGGTTAGG + Intergenic
1015479981 6:133698369-133698391 ATACTATCACATTGGGGGTTAGG - Intergenic
1015735672 6:136397536-136397558 ATGTATTTACCTTGGGGGTTAGG - Intronic
1015863987 6:137709454-137709476 ATATAGTCACATTGGGAGCTAGG - Intergenic
1015873032 6:137796179-137796201 ATATAGTCCCATTGAGGGTTAGG - Intergenic
1016161016 6:140879487-140879509 ATGCAGTCACATTAGGGGTTAGG - Intergenic
1016285583 6:142468975-142468997 ATATTGTCACCTTGGGAGTTAGG + Intergenic
1016301326 6:142635078-142635100 ATACAGTCACATTGTGGGTTAGG + Intergenic
1016431961 6:143994735-143994757 ATACAGTCACATTAGGGTTTGGG - Intronic
1016460096 6:144272836-144272858 ATACTATCACATTGGGGGTTAGG + Intergenic
1016522510 6:144962568-144962590 ATACCATCACATTGGGGGTTAGG - Intergenic
1016736365 6:147484616-147484638 ATACAGCCACACTGGGGGTTTGG + Intergenic
1016760306 6:147729259-147729281 ATAAAGTCACATTTGGGGCTAGG + Intronic
1016876534 6:148870992-148871014 ATATCATCACACTGGGGGTTAGG - Intronic
1016911032 6:149199512-149199534 ATATAGTCACACTGGGAGTTAGG - Intergenic
1016915525 6:149240896-149240918 ATATTGTCACATTTGGGGTTAGG - Intronic
1016977417 6:149822962-149822984 CTGCAGTCACAATAGGGGTTAGG + Intronic
1017026126 6:150182537-150182559 ATGTCATCACTATGGGGGTTAGG + Intronic
1017051743 6:150399892-150399914 ATACCATCACATTGGGGGTTAGG + Exonic
1017064507 6:150517109-150517131 ATATAGTCAGATTGGGGGTTAGG - Intergenic
1017084927 6:150705021-150705043 ATACAGTCACTTTGGGGGTTAGG + Intronic
1017180905 6:151550905-151550927 ATACCATCACATTGGGGGTTAGG + Intronic
1017205483 6:151800457-151800479 ATACAGTCACATTGAGTGTTAGG - Intronic
1017272243 6:152521000-152521022 ATGTAGTCAGATAGGAGGATGGG - Intronic
1017283913 6:152652590-152652612 ATATAGTCACATTGAAGGTTAGG + Intergenic
1017429576 6:154358012-154358034 ATACAATCACATTGGGGATTAGG - Intronic
1017459208 6:154633426-154633448 ATGCCATTACATTGGGGGTTAGG - Intergenic
1017870945 6:158486173-158486195 ATACAGTCACATTGGGAGTCAGG - Intronic
1018038436 6:159901233-159901255 ATAGAGTCACATTGAGGATTAGG + Intergenic
1018275700 6:162128677-162128699 ATGCTATCACATTGGGGATTAGG - Intronic
1018297189 6:162361293-162361315 ATACGATCACATTGGGGGTTAGG - Intronic
1018351349 6:162962461-162962483 ATGCTATCACATTGGGGTTTGGG - Intronic
1018383372 6:163280847-163280869 ATACAGCCACACTGGGGGTTAGG + Intronic
1018445463 6:163854062-163854084 ATATAGTCACATGGGGAGTGAGG + Intergenic
1018926580 6:168211055-168211077 ATGCAGCCACACTGGGGCTTAGG - Intergenic
1019162082 6:170075657-170075679 ATCCAGCCACATTGGGGGTTAGG + Intergenic
1019788597 7:2995759-2995781 ATACAATCACATTGGGAGTTTGG + Intronic
1020552645 7:9625958-9625980 ATATAGTCACATTGGAGGTTAGG - Intergenic
1020588124 7:10097922-10097944 ATGTACTCATATTGGGTGTACGG + Intergenic
1020739055 7:11990226-11990248 ATGCAGTCACATTGTGAATTAGG + Intergenic
1020768272 7:12353379-12353401 ATATAGCCACACTGGGAGTTAGG + Intronic
1020776033 7:12454964-12454986 GTATAGTAACACTGGGGGTTAGG + Intergenic
1020876408 7:13700171-13700193 ATACAGTCACATTGAGGGTCAGG + Intergenic
1021022626 7:15622790-15622812 ATGCCGTCACCTTGAGGGTTAGG - Intronic
1021152271 7:17166079-17166101 ATATAGTCACACTGGGAGTTAGG + Intergenic
1021414742 7:20369580-20369602 ATACTGTCACATTGGAGGTTAGG + Intronic
1021523933 7:21565353-21565375 ATACAGTCACATTGGGAGTTAGG + Intronic
1021808122 7:24376805-24376827 ATACAGTCACATCAGGGGTTAGG - Intergenic
1021816503 7:24452354-24452376 ATACCATCACATTGGGGGTTAGG - Intergenic
1021824058 7:24530122-24530144 ATATCATCACCTTGGGGGTTAGG + Intergenic
1021893900 7:25215156-25215178 ATACAATCACATTGGAGGTTAGG - Intergenic
1022041973 7:26590162-26590184 ATACAGTCACAATGGGGGTTAGG - Intergenic
1022069745 7:26901144-26901166 ATGTAGTTAAATTGAGGGTCAGG + Intronic
1022120265 7:27301585-27301607 ATACAGTCACACTGGAGGTTAGG - Intergenic
1022512226 7:30946127-30946149 ATATCATCACATTGAGGGTTAGG - Intronic
1022617877 7:31951200-31951222 ACATAGTCACATTGGGTGTTAGG + Intronic
1022664737 7:32399929-32399951 ATATAGTTATATTGTGGGTTAGG + Intergenic
1022939412 7:35218783-35218805 ATATTGTCACATTGGTGATTAGG - Intronic
1022949996 7:35329077-35329099 ATGCCATCACATTGGGGATTAGG - Intergenic
1022992577 7:35722970-35722992 ATACAGCTACATTGGGGGTTAGG + Intergenic
1023184590 7:37519794-37519816 ATACTGTCACATTGGGGATTAGG - Intergenic
1023507706 7:40917906-40917928 ATACCATCACATTGGGGGTTAGG + Intergenic
1024009118 7:45252724-45252746 ATATCATCACCTTGGGGGTTAGG + Intergenic
1024101571 7:46037648-46037670 ATAAGGTCACACTGGGGGTTAGG + Intergenic
1024114266 7:46177610-46177632 ATATCATCACCTTGGGGGTTAGG - Intergenic
1024196971 7:47068904-47068926 ATGCAATCATATTGGGGGTTAGG - Intergenic
1024210263 7:47197317-47197339 ATATAGTTATATTAGGGGTTAGG - Intergenic
1024214967 7:47240772-47240794 ATACAGTCACACTGGGGGTTAGG - Intergenic
1024331412 7:48159254-48159276 ATACAGTCACATTGGGGGTTAGG + Intergenic
1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG + Intergenic
1024392648 7:48832793-48832815 ATTTCTTCACATTGGGGATTAGG + Intergenic
1024548517 7:50541441-50541463 ATGCCATCACTTTGGGGGTTAGG - Intronic
1024582203 7:50809335-50809357 ATACAGTCACATTGGGGTTTGGG + Intergenic
1024774307 7:52764610-52764632 ATACAGTCATATTGAGGGTTAGG - Intergenic
1025070113 7:55890496-55890518 ATAAAGTCACATTGCGGGTTAGG + Intronic
1025279502 7:57616498-57616520 ATGTAGTCAGATTCGTGTTTAGG - Intergenic
1025305229 7:57849002-57849024 ATGTAGTCAGATTCGTGTTTAGG + Intergenic
1025963838 7:66249103-66249125 ATACAGTCACATTGGTGATTAGG + Intronic
1026330014 7:69343878-69343900 AAACAGTCACATTGGGGGTTAGG - Intergenic
1026674085 7:72414893-72414915 ATATAGTCACATTGGGGTTGAGG - Intronic
1027409833 7:77904761-77904783 ACGTAGTCACATTGTGGGTTAGG + Intronic
1027694101 7:81387217-81387239 ATACAGTCACATTGGAGGTTAGG + Intergenic
1027720535 7:81735998-81736020 ATATAGTCACAATGGGAGTTGGG + Intronic
1027857935 7:83536902-83536924 ATATAGTGATATTTGGGGTTAGG - Intronic
1028003404 7:85530698-85530720 ATGTAGTCCCACTGGGGATTAGG - Intergenic
1028204105 7:87996518-87996540 ATATAATCACATTGGAGGTTAGG + Intronic
1028462838 7:91115478-91115500 ATGCCATCACATTAGGGGTTAGG + Intronic
1028603596 7:92630035-92630057 ATAGCATCACATTGGGGGTTAGG + Intronic
1028892289 7:96001809-96001831 ATACAGTCACATTGAGGGTGGGG + Intronic
1028978047 7:96935922-96935944 ATACAGTCACATTTGGGTTTAGG - Intergenic
1029982940 7:104896153-104896175 ATACAGTCGTATTGGGGGTTAGG + Intronic
1029989754 7:104952406-104952428 ATACAGTCACATTGGGGTTAGGG + Intergenic
1030017616 7:105240310-105240332 ATACCATCACATTGGGGGTTAGG + Intronic
1030175736 7:106651162-106651184 ATGCCATCACATTGGTGGTTAGG + Intergenic
1030177202 7:106666941-106666963 ATACAGTCACACTGGGGATTAGG - Intergenic
1030214655 7:107032090-107032112 ATGCGGTCACATTGGGGGTTAGG - Intergenic
1030240596 7:107318814-107318836 ATACAGTTACACTGGGGGTTAGG + Intronic
1030388829 7:108900281-108900303 AAATAGTCTCACTGGGGGTTAGG + Intergenic
1030452747 7:109733131-109733153 ATATAGTCACATTAAGGGTTAGG - Intergenic
1030543812 7:110867364-110867386 ATATCATTACATTGGGGGTTAGG + Intronic
1030653252 7:112138707-112138729 AAACTGTCACATTGGGGGTTAGG - Intronic
1031016188 7:116579048-116579070 ATATCATCACCTTGGGGGTTAGG + Intergenic
1031147072 7:118008249-118008271 ATACAATCACATTGGGGGTTAGG + Intergenic
1031171668 7:118299356-118299378 ATATAGCCACATTGATGGTTAGG + Intergenic
1031224740 7:119021530-119021552 ATATAGTCACACTGGGGTTTAGG + Intergenic
1031322430 7:120348072-120348094 ATACCATCACATTGGGGGTTAGG + Intronic
1031371417 7:120971431-120971453 TTATAGTCACGTTGGGGGTTAGG + Intronic
1031628453 7:124017928-124017950 ATTCAGTCACATTGAAGGTTAGG - Intergenic
1031809533 7:126348286-126348308 ATAGAGTCACATTAGAGGTTAGG + Intergenic
1031849308 7:126844891-126844913 AAATAGTCACATTGGAGGTTAGG + Intronic
1031889000 7:127272712-127272734 ATGTACTCTCATTGGAGGTAAGG - Intergenic
1032109253 7:129061286-129061308 ATACAGTCACATTGGGGGCTAGG + Intergenic
1032244369 7:130196558-130196580 AAACAGCCACATTGGGGGTTAGG - Intronic
1032647478 7:133841268-133841290 ATACTGTCACCTTGGGGGTTAGG + Intronic
1032762379 7:134955723-134955745 GTACAATCACATTGGGGGTTAGG + Intronic
1032918178 7:136514745-136514767 AAATAGTCACATGGGGGGTTGGG - Intergenic
1033046456 7:137966926-137966948 ATACTATCACATTGGGGGTTAGG - Intronic
1033048410 7:137982782-137982804 ATACTGTCACATTGGAGGTTAGG - Intronic
1033310975 7:140261564-140261586 ATACAGTCACATCGGGGGTTAGG - Intergenic
1033821779 7:145143001-145143023 ATGGAGTGACAATGGGGTTTTGG + Intergenic
1034020947 7:147641588-147641610 ATATAGTCACATTGGGTGTTAGG - Intronic
1034069105 7:148165361-148165383 ATGCAGTCACATTGGAGGTTAGG + Intronic
1034175871 7:149099364-149099386 TTACAGTCACACTGGGGGTTAGG + Intergenic
1034288515 7:149907981-149908003 ATACAGTCACATTGAGGGTTAGG - Intergenic
1034512697 7:151549358-151549380 ATGCTGTCACACTGGGGATTAGG - Intergenic
1034526397 7:151666222-151666244 ATACAGTCACATTGGAGGTTAGG - Intronic
1034608340 7:152339699-152339721 ATATAGTCAAATTGGGGCTGTGG - Intronic
1034624125 7:152479399-152479421 ATACAGTGATATTGGGGGTTAGG - Intergenic
1034662558 7:152784886-152784908 ATACAGTCACATTGAGGGTTAGG + Intronic
1034848127 7:154466655-154466677 ATAGAATCACATTGGGGGTTAGG + Intronic
1034992162 7:155554807-155554829 ACACAGTCACATTAGGGGTTAGG + Intergenic
1035116905 7:156532459-156532481 ACACAGTCACATTGGGGGTTAGG + Intergenic
1035123796 7:156592593-156592615 ATATAGCCACACTGGAGGTTAGG - Intergenic
1035985207 8:4422356-4422378 ATCTAGTTATGTTGGGGGTTGGG - Intronic
1036114352 8:5942218-5942240 ATGCAGTCACACTGGGGTTAGGG + Intergenic
1036123348 8:6041247-6041269 ATAAAATCACATTGGGGATTAGG + Intergenic
1036539359 8:9689050-9689072 ATGCTATCATATTGGGGGTTGGG + Intronic
1037021298 8:13974901-13974923 ATACAGTCACATTGGGGATTAGG - Intergenic
1037537104 8:19835013-19835035 ATGCCCTCACATTGGGGGTTAGG + Intronic
1037737640 8:21580208-21580230 ATACAGTCACATTGGGGGTTAGG - Intergenic
1038145832 8:24894816-24894838 ATGTCATCATACTGGGGGTTAGG - Intergenic
1038373850 8:27018289-27018311 ATACAGTCACACTGGGAGTTAGG + Intergenic
1038485624 8:27933032-27933054 ATACAGTCACATTGGGGGTTAGG + Intronic
1038697195 8:29817243-29817265 GTGTCATCACATTGGGGATTAGG - Intergenic
1038867724 8:31457998-31458020 ATGTAGCCACACTAGGGGTTAGG - Intergenic
1039137461 8:34341731-34341753 ATATCATCACATTGGGAGTTAGG - Intergenic
1039460928 8:37743545-37743567 ATACAGTCACATTGGGGGTTAGG + Intronic
1039630804 8:39109013-39109035 ATACTGTCACATTGGGGGTTAGG + Intronic
1039631692 8:39119812-39119834 ATATAGTCACATTAGGGGTTAGG - Intronic
1039742299 8:40393899-40393921 ATACAATCACCTTGGGGGTTCGG + Intergenic
1040016448 8:42704247-42704269 ATATAGTCACGTTGGGGGTTAGG + Intronic
1040541600 8:48362065-48362087 ATGCAGCCACACTGGGGGTTAGG + Intergenic
1040551793 8:48443733-48443755 ATGGAGTCAGATTTGGGGTTGGG + Intergenic
1040724730 8:50369194-50369216 ATACAGTCACATTAGGGGTTAGG - Intronic
1040828129 8:51646089-51646111 ATTTAGTCACGTGAGGGGTTAGG - Intronic
1040832771 8:51696204-51696226 ATGCAGTCAGATGGGGGTTTAGG - Intronic
1040871473 8:52104139-52104161 ATATCATCACCTTGGGGGTTAGG - Intergenic
1040982901 8:53263746-53263768 ATTCAGTCACATTGAGGGTTAGG + Intergenic
1041128959 8:54676105-54676127 ATGTTATCACATTGGGTCTTAGG + Intergenic
1041599007 8:59693607-59693629 GTACAGTCACATTGGAGGTTAGG - Intergenic
1041600424 8:59711274-59711296 ATACAACCACATTGGGGGTTAGG - Intergenic
1041775945 8:61522926-61522948 ATACAGTCACACTGGGGGTTAGG + Intronic
1042621776 8:70714225-70714247 ATATAGTCACATTGGGAGTTAGG + Intronic
1042653102 8:71065206-71065228 ATGCAGTCACATTGGGGGTTAGG - Intergenic
1042865403 8:73352656-73352678 ATATCATCACATTGGAGGTTAGG - Intergenic
1043197508 8:77316287-77316309 ATATAGTCACATTCAGGGTTAGG - Intergenic
1043928067 8:86060577-86060599 ACATAGCCACACTGGGGGTTAGG - Intronic
1043984594 8:86679392-86679414 ATTCAGTCACATTAGGGGTTAGG - Intronic
1044079558 8:87867025-87867047 ATACAGTCACATTGGGGGTTAGG - Intergenic
1044341472 8:91050775-91050797 ATATAGTCACATTGCAGATTAGG - Intergenic
1044369982 8:91399097-91399119 ATGCAGTCACTTTGAGGGTGAGG + Intergenic
1044370172 8:91400895-91400917 ATATAGTCACATTGGAGATTAGG + Intergenic
1044475106 8:92616794-92616816 ATATGGTCACATTGAGGGCTAGG + Intergenic
1044586849 8:93876266-93876288 ATACAGTCACATTGGAGGTTAGG + Intronic
1044613495 8:94116899-94116921 ATATAGTCACGTTGGGGGTTAGG + Intergenic
1044667682 8:94647656-94647678 AGATAGTTACATTGGGGGTTGGG + Intronic
1044740398 8:95320857-95320879 ATATAGTCACATTGGGGGTTAGG - Intergenic
1045407597 8:101882282-101882304 ATATAATCACCTTGGGGGTTAGG - Intronic
1045474433 8:102540984-102541006 ATACAGTTACGTTGGGGGTTAGG + Intergenic
1045669335 8:104530293-104530315 ATACAGTCACATTGGGAGTTAGG - Intronic
1045687693 8:104728488-104728510 ATGCCGTCATATTGGGGGTAAGG + Intronic
1045793866 8:106020098-106020120 ATACAGTCATATTGGGGATTAGG - Intergenic
1045859792 8:106803216-106803238 GTATCATCACATTGGGGGTTAGG + Intergenic
1046120676 8:109842549-109842571 ATTCAGTCACACTAGGGGTTGGG - Intergenic
1046304689 8:112349902-112349924 ATACAGTCACATTAGGGGTTAGG - Intronic
1046470779 8:114671043-114671065 ATATAGTTATATTCGGGGTTAGG - Intergenic
1046724181 8:117656329-117656351 ATACAGTCACATGGAGGGTTAGG + Intergenic
1046863771 8:119123501-119123523 ATGCCTTCACACTGGGGGTTAGG + Intergenic
1047000009 8:120564192-120564214 ATACAGTCACCTTGGAGGTTAGG - Intronic
1047147050 8:122214107-122214129 ATATAGTCACACTGAGGCTTAGG - Intergenic
1047441064 8:124879161-124879183 ATACCATCACATTGGGGGTTAGG + Intergenic
1047450298 8:124959328-124959350 ATATAGGCACACTGGGGGTTAGG + Intergenic
1047496910 8:125415113-125415135 ATGTAGTCACCCTGGGGCTTAGG + Intergenic
1047574756 8:126140554-126140576 ATACAGTCACATTGAGGGTTAGG + Intergenic
1047767886 8:128004127-128004149 ATAAAGTCACCTTAGGGGTTGGG + Intergenic
1047894066 8:129345399-129345421 ATGCAATCACACTGGGGGCTAGG + Intergenic
1047896168 8:129368891-129368913 ATACCGTCACATTGGGGGTCGGG - Intergenic
1048050889 8:130814973-130814995 ATGCCATCACATTGGGGGTTAGG - Intronic
1048128819 8:131668874-131668896 ATACAGTCATACTGGGGGTTAGG + Intergenic
1048140643 8:131790962-131790984 ATGCAGTCACAGTGGAGGTTAGG + Intergenic
1048577324 8:135703315-135703337 ATACAGTCACATTGAGGGTTAGG - Intergenic
1048702147 8:137103634-137103656 AGATGGTCACATTGGGGGTTTGG + Intergenic
1048781885 8:138010842-138010864 ATATAGTCACATTGGTAGTTCGG + Intergenic
1049596530 8:143486548-143486570 ACGTAGTCACATTGGGGGTTAGG + Intronic
1049864471 8:144925050-144925072 ATGTAGTCAGTTTGTAGGTTTGG - Intergenic
1049984048 9:931792-931814 ATACAGTCACATTGGGAGCTAGG + Intronic
1050053849 9:1631505-1631527 ATGCCATCACATTGGGGATTAGG + Intergenic
1050164937 9:2755601-2755623 ATATAGCCACAATGGGGGTTGGG + Intronic
1050350205 9:4734049-4734071 ATATAGTCACCCTGGGGGTTAGG - Intronic
1050511087 9:6396610-6396632 ATATAGTCACATTGAGGGTTAGG - Intergenic
1050772651 9:9221698-9221720 ATACAGTTACATTGGGTGTTGGG + Intronic
1050823092 9:9907625-9907647 ATAAAGTCACATTGGGGATTAGG + Intronic
1051109171 9:13616057-13616079 AAACAGTCACATTTGGGGTTAGG - Intergenic
1051164425 9:14246832-14246854 ATGCAGTTACACTGGGGATTGGG - Intronic
1051261197 9:15266678-15266700 ATTCCATCACATTGGGGGTTTGG - Intronic
1051326849 9:15981179-15981201 ATATTATCACATTGGGGGTTAGG - Intronic
1051744788 9:20285202-20285224 ATGCAGTCACATTGGATGTTAGG - Intergenic
1052121862 9:24728396-24728418 ATAAAGGCACATTGGGAGTTAGG - Intergenic
1052165960 9:25328015-25328037 CTGTAGTCATATTGGAAGTTAGG + Intergenic
1052295835 9:26895258-26895280 ATTCAGTCACATTGGGGTTAGGG - Intergenic
1052399105 9:27978388-27978410 ATGCCATCACCTTGGGGGTTAGG - Intronic
1052551715 9:29959167-29959189 ATTTAGTCATATTGGAGGTTAGG - Intergenic
1052624321 9:30955807-30955829 ATACAGTCACATTGGGAGATAGG - Intergenic
1052649528 9:31283572-31283594 ATACAGTCACATTAAGGGTTTGG - Intergenic
1053018960 9:34681466-34681488 ATACAGTCACATTTAGGGTTAGG - Intergenic
1053096940 9:35336750-35336772 ATGTCATCACCTTGAGGGTTAGG + Intronic
1053205798 9:36185648-36185670 ATATAGCCACACTTGGGGTTAGG - Intergenic
1053348806 9:37397897-37397919 ATACAGTCACATTGGGGTTTAGG + Intergenic
1053585572 9:39455095-39455117 ATACAGTTACACTGGGGGTTAGG - Intergenic
1053869916 9:42480212-42480234 GTGTAGCCAAATTGGAGGTTAGG - Intergenic
1054086377 9:60748937-60748959 ATGTAGCCAAATTGGCAGTTAGG + Intergenic
1054580739 9:66910130-66910152 ATACAGTTACACTGGGGGTTAGG + Intronic
1054833500 9:69651907-69651929 ATGCAGTCACATTGGGGGTTTGG - Intronic
1054981452 9:71211028-71211050 ATACAGTCACGTTGAGGGTTAGG + Intronic
1055167169 9:73210949-73210971 ATATTATCACCTTGGGGGTTAGG + Intergenic
1055182953 9:73412015-73412037 GTATGGTCACATTAGGGGTTAGG - Intergenic
1055390380 9:75815394-75815416 ATATTGTCACATTGGTGGTTAGG + Intergenic
1055416668 9:76091462-76091484 ATATAGTCACATTGGTCTTTAGG + Intronic
1055653583 9:78432067-78432089 ATACAGTGACATTGGGGGTTAGG - Intergenic
1055674011 9:78636568-78636590 ACACAGTGACATTGGGGGTTAGG - Intergenic
1055684965 9:78762914-78762936 AAATAGTCACATTGAAGGTTAGG - Intergenic
1055689789 9:78817053-78817075 ATACAGTCACATTGGGGATTAGG + Intergenic
1055702438 9:78960337-78960359 ATATAGTCACACTGGTGGTTAGG - Intergenic
1055742711 9:79407478-79407500 GAATAGTCACATTGAGGGTTAGG + Intergenic
1055877339 9:80959335-80959357 ATGCCATCCCATTGGGGGTTAGG - Intergenic
1056177409 9:84048989-84049011 ATATAATCGCAATGGGGGTTAGG - Intergenic
1056442592 9:86635621-86635643 ATACCATCACATTGGGGGTTGGG - Intergenic
1056819791 9:89831211-89831233 ATACAGTCACATTGGAGGTTAGG - Intergenic
1056844769 9:90027707-90027729 ATGCTTTCACATTGGGGATTAGG + Intergenic
1057289864 9:93798713-93798735 ATATTATCACATTGGTGGTTAGG - Intergenic
1057320089 9:94004777-94004799 ATACAGTCACATTTGGAGTTAGG + Intergenic
1057522125 9:95768526-95768548 ATACCATCACATTGGGGGTTAGG - Intergenic
1057560045 9:96120239-96120261 ATGTTTTTACATTGTGGGTTGGG - Intergenic
1057582067 9:96295858-96295880 GTGTCATCTCATTGGGGGTTAGG - Intronic
1057583211 9:96306162-96306184 ATATCATCACACTGGGGGTTAGG - Intergenic
1057589644 9:96361284-96361306 ATACAGTCACATTGGGGATTAGG - Intronic
1057952720 9:99382756-99382778 ATATAGTCACACTGGGGGTTAGG - Intergenic
1058014490 9:100015105-100015127 ATACTGTCACATTGGGGATTAGG + Intronic
1058023742 9:100117785-100117807 ATATCATCACATTGAGGGTTAGG - Intronic
1058141015 9:101356914-101356936 ATGTCATCACCTTGGGGATTAGG + Intergenic
1058304896 9:103427590-103427612 ATACCATCACATTGGGGGTTAGG + Intergenic
1058529375 9:105890508-105890530 ATATAGTCACCTTGGGAGGTTGG - Intergenic
1058850304 9:109005417-109005439 ATACCATCACATTGGGGGTTAGG - Intronic
1059179353 9:112197382-112197404 ATGCAGTCACGTTGTGGGTGAGG - Intergenic
1059365428 9:113783118-113783140 ATTCAGTCACATTGGGGATTAGG - Intergenic
1059388927 9:113986679-113986701 ATCCAGTCACACTGGGGGTTAGG + Intronic
1059496972 9:114718009-114718031 ATACAGTCACCTTGGGGGTTAGG - Intergenic
1059521305 9:114944645-114944667 ATATCATCACATTGGAGGTTAGG + Intergenic
1059535204 9:115074286-115074308 ATGTCTTCACATTGGGGATTAGG - Intronic
1059898839 9:118899470-118899492 ATACTGTCACATTGGGGATTAGG + Intergenic
1060345057 9:122808662-122808684 ATACAGTCACTTTGGGGGTTTGG + Intronic
1060496343 9:124121981-124122003 ATACAGTCACACTGGGGGTTAGG + Intergenic
1186007931 X:5094867-5094889 ATATAGTCACATTGTGGGTTGGG + Intergenic
1186155330 X:6719370-6719392 ATACAGTCACATTGCGGGGTAGG + Intergenic
1186313924 X:8348646-8348668 ATGCCATCACTTTGGGGGTTAGG + Intergenic
1186320320 X:8417114-8417136 ACACAGTCATATTGGGGGTTAGG + Intergenic
1186683748 X:11902590-11902612 ATTCTATCACATTGGGGGTTAGG + Intergenic
1186685559 X:11921441-11921463 ATACAATCACATTGGGGGTTAGG + Intergenic
1186806442 X:13144754-13144776 ATACTATCACATTGGGGGTTAGG + Intergenic
1186818562 X:13262741-13262763 ATCTAATCACATTGGTGGCTAGG - Intergenic
1186880901 X:13865220-13865242 ATTTAGTGACATGGAGGGTTGGG - Intronic
1187138106 X:16567842-16567864 ATGCCGTCACATTGGGGATTAGG + Intergenic
1187215608 X:17273071-17273093 ATATAGTCACATTTGAGATTAGG + Intergenic
1187306149 X:18097026-18097048 ATGCAGTCACATTCGGGGTTAGG + Intergenic
1187581920 X:20616321-20616343 ATACAGTCACATTGGGGATTAGG + Intergenic
1188023833 X:25187538-25187560 ATACCATCACATTGGGGGTTAGG - Intergenic
1188057709 X:25560848-25560870 ATATCATCACATTGGGGATTAGG + Intergenic
1188266335 X:28080583-28080605 ATATAATCACATTGGGGTTGAGG - Intergenic
1188287007 X:28339349-28339371 ATACAGTCACATTGGGGGTTAGG + Intergenic
1188362882 X:29278410-29278432 ATGAAGTTACATTGGGGAGTGGG - Intronic
1188672361 X:32895174-32895196 ATATCGTCCCATTGGGGGTTAGG + Intronic
1188929437 X:36088378-36088400 ATAAAATCACATTGGGGGTTAGG - Intronic
1188936812 X:36185935-36185957 ATACGGTCACATTGGTGGTTAGG + Intergenic
1188953712 X:36408458-36408480 ATATGGTCACATTGGAGGTTAGG + Intergenic
1189194064 X:39137424-39137446 ATATAGTTACACTGGGGGTTAGG - Intergenic
1189343687 X:40223866-40223888 ATGCAGTCACATTGGGGTTAGGG + Intergenic
1189420190 X:40850500-40850522 ATACAGTCACATTGAGGATTAGG + Intergenic
1189545871 X:42042188-42042210 ATACAGTCACATTGGGGGTTAGG + Intergenic
1189560210 X:42184640-42184662 ATATCATCACATTGAGGGTTAGG - Intergenic
1189605640 X:42674787-42674809 ATACAGTCATATTGGGTGTTAGG + Intergenic
1189629950 X:42942436-42942458 ATATAGTCACATTGGGGGTTAGG - Intergenic
1189681846 X:43525411-43525433 ATATGGTTACATTGGGGGTTAGG - Intergenic
1190089988 X:47429199-47429221 TTTCAGTCACATTGAGGGTTAGG + Intergenic
1190155721 X:47991077-47991099 ATATAGTCACATTGGGGGTTAGG - Intronic
1190156381 X:47996666-47996688 ATACAGTCACATTGCAGGTTGGG - Intronic
1190451856 X:50590122-50590144 ATGCCATCACATTGGGGATTAGG - Intergenic
1190509848 X:51163863-51163885 TCCAAGTCACATTGGGGGTTAGG - Intergenic
1190838811 X:54127170-54127192 ATACCATCACATTGGGGGTTAGG + Intronic
1190857988 X:54316155-54316177 ATACAGTCACATTGGGGTTGGGG - Intronic
1191160173 X:57321310-57321332 ATTAGGGCACATTGGGGGTTCGG + Intronic
1191168957 X:57421661-57421683 ATACAGTCACATTAAGGGTTAGG + Intronic
1191752317 X:64556287-64556309 ATACAGTCAGATTGGGGGTTAGG - Intergenic
1192251214 X:69415380-69415402 ATACAGTCACATTGGGGGTTAGG + Intergenic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1192597473 X:72426789-72426811 GTATAGTCACAGTGGGGGTTAGG - Intronic
1192622263 X:72690373-72690395 ATATAGTCATATTAGGGGTTAGG - Intronic
1192918422 X:75679670-75679692 ATATTGTCACATTAGGGGTTAGG + Intergenic
1193368468 X:80663471-80663493 ACACAGTCATATTGGGGGTTAGG - Intergenic
1193781080 X:85701971-85701993 ATACAGTCACATTGGGGTTGGGG - Intergenic
1193825590 X:86222078-86222100 ATACTTTCACATTGGGGGTTAGG + Intronic
1194234659 X:91367311-91367333 ATGCCATCACATTGGAGGTTAGG - Intergenic
1194310939 X:92305584-92305606 TGCAAGTCACATTGGGGGTTGGG + Intronic
1194509166 X:94771238-94771260 ATGCAGTCATATTGGGATTTAGG - Intergenic
1194597535 X:95877307-95877329 ATGTCATCACATTGGGGGCTAGG + Intergenic
1194798931 X:98247450-98247472 ATATAGTCACATTGGGGGTTAGG - Intergenic
1194819410 X:98487723-98487745 ATACAGTCACATTGGGGTTGGGG + Intergenic
1194957570 X:100198629-100198651 ATGTCATCACCTTGGGGATTAGG - Intergenic
1195197423 X:102513049-102513071 ATATAATCACACTGGAGGTTAGG + Intergenic
1195385847 X:104313066-104313088 ATATAGTCACATTGGAGGTTAGG - Intergenic
1195462742 X:105145880-105145902 ATACTATCACATTGGGGGTTAGG - Intronic
1195508885 X:105691092-105691114 ATGCAGTCACATTGAGGGTTAGG + Intronic
1195513616 X:105745996-105746018 ATATAATCACCTTGGGGGTTAGG + Intronic
1195536965 X:106020014-106020036 ATACAGTCACTTTGGGGCTTAGG - Intergenic
1195571063 X:106399243-106399265 ATTCAGTCACATTGGGAGTTGGG + Intergenic
1195950758 X:110270182-110270204 ACACAGTCACATTAGGGGTTAGG + Intronic
1196187682 X:112762115-112762137 ATGCAGTCACATTGGGAGTTAGG + Intergenic
1196413239 X:115442547-115442569 ATATCATCCCATTGGGGGTTAGG + Intergenic
1196483444 X:116178368-116178390 ATATCATTACATTGGGGGTTGGG - Intergenic
1196873906 X:120139482-120139504 ATACAATCACATTAGGGGTTAGG - Intergenic
1196889443 X:120277937-120277959 ATACAGTCACATTGGGGGATAGG - Intronic
1197012006 X:121576403-121576425 ATATAATCACATTGGGGATTAGG - Intergenic
1197033952 X:121852789-121852811 ATATAGTCACATTGGATGTTAGG + Intergenic
1197270908 X:124423857-124423879 ATACAGTCACACTGGGGGTTAGG - Intronic
1197387216 X:125816234-125816256 ATACAATCACATTGGGGGTGCGG - Intergenic
1197446748 X:126559665-126559687 ATACAGTCACATTGGGTATTAGG + Intergenic
1197456673 X:126684508-126684530 ATACAGTAACATTGGAGGTTAGG - Intergenic
1197551447 X:127897594-127897616 GTACAGTCACTTTGGGGGTTAGG - Intergenic
1197686900 X:129450083-129450105 ATACAGTCACATTGAAGGTTAGG - Intronic
1197711821 X:129677129-129677151 GTATAGTGATATTGGGGGTTAGG - Intergenic
1197731916 X:129818025-129818047 GTGCAGCTACATTGGGGGTTAGG - Intronic
1197883042 X:131189512-131189534 ATACTGTCACATTGGGGATTAGG - Intergenic
1197925438 X:131642374-131642396 ATATCAACACATTGGGGGTTAGG + Intergenic
1197966115 X:132063913-132063935 ATACCATCACATTGGGGGTTAGG - Intergenic
1198078843 X:133219583-133219605 ATACAGTCAAATTGGGGGTTAGG + Intergenic
1198078857 X:133219694-133219716 GAGTAGTGAAATTGGGGGTTAGG + Intergenic
1198079115 X:133222090-133222112 ATATAGTCAAATTGGGTGTTTGG + Intergenic
1198170540 X:134101148-134101170 ACATAGTCATTTTGGGGGTTAGG - Intergenic
1198409614 X:136353109-136353131 ATATAACCACATTCGGGGTTAGG + Intronic
1198472808 X:136964736-136964758 GTATAATCACATTGGAGGTTAGG + Intergenic
1198734422 X:139770880-139770902 ATACAATCACATTGGGGGTAGGG - Intronic
1198971444 X:142285433-142285455 ATGTCATCACATTGGGTATTAGG + Intergenic
1199018031 X:142842331-142842353 ATTTAGTTACATAGGAGGTTAGG + Intergenic
1199311354 X:146324727-146324749 ATATCATCACATTAGGGGTTAGG - Intergenic
1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG + Intergenic
1199692427 X:150318723-150318745 ATACCATCACATTGGGGGTTAGG + Intergenic
1199748348 X:150790903-150790925 ATATCATCACATTGGAGGTTAGG - Intronic
1199827348 X:151513734-151513756 CTGTTGTTAGATTGGGGGTTGGG + Intergenic
1199927629 X:152484684-152484706 ATACAGTGACATTGGGCGTTAGG + Intergenic
1200619214 Y:5419859-5419881 TGCAAGTCACATTGGGGGTTGGG + Intronic
1200833941 Y:7714429-7714451 ATATAGTCACATTGGGGGTTAGG - Intergenic
1201148180 Y:11078008-11078030 ATGCCATCACATTGGGGGTTAGG - Intergenic
1201646644 Y:16240649-16240671 ATCCAGTCACATTGGGAGTTAGG + Intergenic
1201656169 Y:16344668-16344690 ATCCAGTCACATTGGGAGTTAGG - Intergenic
1201672715 Y:16542319-16542341 ATATAGTCACATAGGGAGTTGGG - Intergenic