ID: 965329334

View in Genome Browser
Species Human (GRCh38)
Location 3:167351488-167351510
Sequence AGGTCCCAGTGACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965329334_965329338 -9 Left 965329334 3:167351488-167351510 CCTGCTTGGGGTCACTGGGACCT 0: 1
1: 0
2: 0
3: 13
4: 182
Right 965329338 3:167351502-167351524 CTGGGACCTGGACCCAGGGAAGG 0: 1
1: 0
2: 1
3: 65
4: 504
965329334_965329341 3 Left 965329334 3:167351488-167351510 CCTGCTTGGGGTCACTGGGACCT 0: 1
1: 0
2: 0
3: 13
4: 182
Right 965329341 3:167351514-167351536 CCCAGGGAAGGAGTAAGTGAAGG 0: 1
1: 1
2: 7
3: 56
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965329334 Original CRISPR AGGTCCCAGTGACCCCAAGC AGG (reversed) Intronic
900207408 1:1437501-1437523 AGGGCCCAGGGAGCCCTAGCTGG + Intronic
900496645 1:2978832-2978854 AGGGCCCAGGGCCACCAAGCAGG + Intergenic
900987992 1:6084295-6084317 AGGACCCAGTGATGCCAAACAGG + Intronic
901058959 1:6462905-6462927 AGGTCAGGGTGGCCCCAAGCAGG + Exonic
903761163 1:25699782-25699804 GGGTCACAGTGGCCCCATGCCGG + Intronic
904561525 1:31401142-31401164 AGGTTGCAGTGAGCCCAGGCTGG + Intergenic
912278059 1:108281518-108281540 GGCTCCCAGTGACCCCAACCAGG - Intergenic
912290167 1:108412839-108412861 GGCTCCCAGTGACCCCAACCAGG + Intronic
917898589 1:179517589-179517611 AGTTCGCAGGGTCCCCAAGCAGG - Intronic
918671931 1:187228250-187228272 ATTTCCCAGTGACTCAAAGCAGG + Intergenic
919937824 1:202266260-202266282 ATGTCCCTGTGTCCCCAGGCAGG - Intronic
920120949 1:203657821-203657843 AGGTCTCAGAGACTCCACGCAGG + Intronic
922674268 1:227541402-227541424 AGGGGCCAGAGACACCAAGCAGG - Intergenic
922800551 1:228362857-228362879 AGGCCCCAGTGACCCCGATTTGG + Intronic
923794795 1:237143335-237143357 AAGTCCCTGTGAGCCAAAGCAGG - Intronic
924648503 1:245902304-245902326 AGGTGGCAGTGGCCCCAGGCAGG - Intronic
1067246406 10:44550319-44550341 TGGTCTCACTGACACCAAGCAGG + Intergenic
1069715029 10:70515187-70515209 AGGTGCTAGTGGCCCAAAGCTGG + Intronic
1070592122 10:77808737-77808759 AGGTCCCTGTGAAGCCAGGCAGG - Intronic
1071093773 10:81949937-81949959 AGATCCCAGCTAACCCAAGCGGG + Intronic
1074394719 10:113088289-113088311 AGGTCCCAGTCAACTCATGCAGG - Intronic
1075795374 10:125116274-125116296 AGGTCACAGTGCCCCACAGCTGG + Intronic
1077496727 11:2890270-2890292 AAGTCTCAGTGACCTCAGGCAGG - Intronic
1077765456 11:5154910-5154932 AGGTGCCAGTGAACCCAAGAGGG - Intronic
1079090642 11:17477539-17477561 AGGTCTCAGTGCCAGCAAGCAGG + Intergenic
1079135896 11:17775845-17775867 AGCTCCCAGGGAGCCCAGGCGGG - Intronic
1080426645 11:32160894-32160916 GGGTCCCATTGACCACAAGGGGG + Intergenic
1081334113 11:41842862-41842884 GGGTCTCAGGCACCCCAAGCTGG + Intergenic
1083396369 11:62395393-62395415 AAGGCCAAGTGTCCCCAAGCAGG + Intergenic
1083694906 11:64436402-64436424 TGGACCAAGAGACCCCAAGCTGG + Intergenic
1083828045 11:65214100-65214122 AGGGCTCAGGGGCCCCAAGCTGG - Intergenic
1083928370 11:65823412-65823434 AGGTGGCAGGGACCCCAGGCAGG + Intronic
1091756611 12:3056520-3056542 TGGTCCCAGTGACCACAGGCTGG - Intergenic
1092144635 12:6205955-6205977 AAGTCCCGCTGACCCCAACCTGG - Intronic
1092539953 12:9414610-9414632 AGGTCCAAGTCACCCCCACCCGG + Intergenic
1092698799 12:11203936-11203958 AGGTCCCAGTAAACCTAGGCTGG - Intergenic
1093086126 12:14868643-14868665 CGTTCCTAGTGACCCCAACCAGG - Intronic
1095102364 12:38198197-38198219 AAGTCCCAGGGAATCCAAGCTGG + Intergenic
1097992709 12:65853027-65853049 AGGTTGCAGTGATCCCAGGCAGG + Intronic
1104492840 12:129209434-129209456 AGGTCCCAGAGGTCCCAAGCTGG + Intronic
1104729513 12:131097302-131097324 AGGTCACTGTGACCCGAGGCAGG + Intronic
1115372538 14:32634144-32634166 AGGTCCCAGTGCCAACTAGCTGG + Intronic
1118311662 14:64698060-64698082 AGGTCCCAGTTGCCCTAATCGGG + Intergenic
1119780347 14:77272853-77272875 AGGTCCACGGGACCCCAAGCTGG - Intergenic
1120697207 14:87657873-87657895 AGGTCTCACTGACCCAAAGTGGG + Intergenic
1122341717 14:101032960-101032982 AGGACCCAGTGACCCATTGCTGG - Intergenic
1123936506 15:25196644-25196666 AGGTAGGAGTGACCTCAAGCGGG - Intergenic
1124380633 15:29162161-29162183 AGCTCCCTGGGTCCCCAAGCAGG + Intronic
1124557032 15:30735957-30735979 AGCTCCCTGGGTCCCCAAGCAGG + Intronic
1124674232 15:31669787-31669809 AGCTCCCTGGGTCCCCAAGCAGG - Intronic
1125388579 15:39166533-39166555 ATCTACCATTGACCCCAAGCAGG + Intergenic
1130254847 15:82321034-82321056 CTGTCCCAGAGACCCCAGGCAGG + Intergenic
1130600126 15:85268972-85268994 CTGTCCCAGAGACCCCAGGCAGG - Intergenic
1132210391 15:100017503-100017525 AGCTCCCTGGGTCCCCAAGCAGG - Intronic
1132606244 16:794934-794956 TGGGCCCAGTGACCCCTTGCTGG + Intronic
1133024738 16:2983669-2983691 CGGTCCCTGTGACCCCAAGGTGG - Intergenic
1136032176 16:27511314-27511336 AGGTCCCAGTTACCTAAGGCTGG - Intronic
1137979063 16:53054791-53054813 AGATCCCAGTGCCCCGCAGCGGG + Intergenic
1138007609 16:53352763-53352785 AGGTCTCACTGTCCCCAGGCTGG - Intergenic
1141238885 16:82246034-82246056 AGGTTGCAGTGAGCCCAGGCTGG + Intergenic
1141627924 16:85271216-85271238 GGGTCCCAGAGCCCCCAAGCAGG + Intergenic
1142161811 16:88561754-88561776 AGGTCTCAGACACCCCAAGGAGG - Intergenic
1142749203 17:1977537-1977559 GGGTCCCAGACACCCCAGGCCGG - Intronic
1143166038 17:4897698-4897720 AGGGCCCAGTGACCCCCCCCAGG - Exonic
1143811175 17:9472945-9472967 AGGTCCTTGTGACTCAAAGCTGG + Intronic
1144696334 17:17306269-17306291 AGGTCCCAGAGAGCTCCAGCAGG + Intronic
1145312535 17:21708356-21708378 CGGTTCCAGTTACCCCAGGCTGG - Intergenic
1145767905 17:27471995-27472017 GGGTCCAGGTGCCCCCAAGCAGG - Exonic
1147844485 17:43395181-43395203 AGGGCCCAAGGACCCCAGGCTGG + Intergenic
1148870496 17:50656443-50656465 AGATTCCCATGACCCCAAGCAGG - Intronic
1151684510 17:75638926-75638948 AGGTCTAAGTGACCACAAGTGGG + Exonic
1152014913 17:77744280-77744302 AGGCCCCAGGGACCCCATGAGGG - Intergenic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152633946 17:81422931-81422953 ATGCCCCAGTGTCCCCAAGCAGG + Intronic
1152706513 17:81846361-81846383 AGAGCCCAGAGACCCCAAGGTGG + Intronic
1155283190 18:24262002-24262024 AGGTCCCAGCAACCACCAGCAGG - Intronic
1155931598 18:31714526-31714548 AAGTCCCAGAGTCCCAAAGCAGG - Intergenic
1156869938 18:41933898-41933920 TGGTCCCAGTGACACCTATCGGG + Intergenic
1159956174 18:74519858-74519880 AGGGCTCAGGGCCCCCAAGCTGG + Intronic
1160566413 18:79788853-79788875 AGAACCCAGAGACCCCGAGCCGG - Intergenic
1161495387 19:4583514-4583536 AGGCCTCAGTGGCCCCCAGCGGG - Intergenic
1161773172 19:6242255-6242277 AGGTTCCAAGGACACCAAGCCGG - Intronic
1161980822 19:7629427-7629449 AGGTCCCAATGCCCCAACGCAGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1163320659 19:16572634-16572656 CGGTCCCAGTGACCGGGAGCCGG + Intronic
1164882039 19:31740911-31740933 AGGTCCCAATGCCCCAAGGCAGG - Intergenic
1165431506 19:35775869-35775891 AGGTCCCTGTCACCCCATCCAGG - Intronic
1166062915 19:40337925-40337947 GGGTCCCACTGACCAGAAGCAGG + Intronic
1166348649 19:42182907-42182929 AGGGCCCTGAGACCACAAGCGGG + Intronic
1166947217 19:46404612-46404634 AGGTGCCAAAGACCCCAAGGAGG + Intergenic
927413823 2:22856038-22856060 AGAGCCCAGGGACCCCAGGCAGG + Intergenic
929265765 2:39917553-39917575 AGGTCAGAGTGAGCACAAGCAGG - Intergenic
929529210 2:42736524-42736546 AGTTCACTGTGACCCCAAGTAGG + Intronic
930872332 2:56182837-56182859 AGGTCTCAGTGTCCCCAATAGGG + Intergenic
931779111 2:65564571-65564593 CAGTCCCAGTGCCCCCCAGCTGG - Intergenic
936261919 2:110966878-110966900 AGGTCCCATCGACACCATGCTGG - Intronic
937317572 2:120941705-120941727 AGGTCCCAGTGTCTCCACTCTGG + Intronic
937437020 2:121889237-121889259 CCATCCCAGTGACCCCAACCTGG + Intergenic
938120927 2:128632504-128632526 AGGGCCAAGAGCCCCCAAGCAGG - Intergenic
942225192 2:173808727-173808749 AAGTCCCAGAGACCAAAAGCTGG + Intergenic
946076398 2:217077169-217077191 AAGTCACAGTGACCTCAGGCCGG - Intergenic
947586929 2:231362133-231362155 AGGTCCCTGGGTCCCCAGGCAGG - Intronic
947603771 2:231470516-231470538 AGCTCCCAGTCACCCCAGCCTGG + Intronic
1168877494 20:1181451-1181473 TGGGCCCAGTGGCCCCAACCAGG - Exonic
1169274513 20:4224576-4224598 AGGTGCCTGTGAGACCAAGCGGG + Intronic
1169274526 20:4224630-4224652 AGGTGCCTGTGAGACCAAGCGGG + Intronic
1169274538 20:4224684-4224706 AGGTGCCTGTGAGACCAAGCAGG + Intronic
1171096299 20:22335309-22335331 AGGTTGCAGTGAGCCCAACCTGG + Intergenic
1172225108 20:33300211-33300233 AGGGCCCAGTGTCCCCACTCGGG - Intronic
1172702037 20:36859695-36859717 AGTTCCCAGTGACCCCTACAAGG + Intronic
1174509282 20:51038801-51038823 AGGTCTCACTGACACCAGGCTGG - Intergenic
1175497479 20:59424520-59424542 ATGGCCCAGTGACCCCAAAGTGG + Intergenic
1176036766 20:63043401-63043423 AGGCCACAGGGACCCCATGCGGG + Intergenic
1178918099 21:36720393-36720415 AGGTACTAGGGACCCCAAGATGG - Intronic
1179286878 21:39985152-39985174 AGGTCCCAGTGATGCAATGCTGG - Intergenic
1179956763 21:44745098-44745120 GGGTCCCAGTGACCACAACAGGG - Intergenic
1180007207 21:45028248-45028270 AGGACCCTGTGACCCCCAGACGG - Intergenic
1181460882 22:23085352-23085374 ATGTCCCCCTGTCCCCAAGCAGG + Intronic
1181849951 22:25742937-25742959 AGGTCCCAGTGGCCCCATAGTGG + Intronic
1184656705 22:45945636-45945658 CAGGCCCAGTGACCCCCAGCAGG - Intronic
1185195654 22:49467750-49467772 ATGTCCCAGGGACAGCAAGCTGG - Intronic
949413491 3:3792224-3792246 AGTTCCCAGAGACTTCAAGCAGG - Intronic
952197307 3:31089284-31089306 AGGACCGAGTGACTGCAAGCAGG - Intergenic
952519797 3:34145297-34145319 TGGTCCCAGTTACCAGAAGCAGG - Intergenic
953044089 3:39280236-39280258 AGGTGCCACTTACCCCAACCTGG + Intronic
953414401 3:42707417-42707439 AGATCCGTGTGACCCCATGCAGG + Intronic
954701738 3:52454151-52454173 TGGTCCCAGTGATCTCAGGCTGG + Intergenic
954815000 3:53273422-53273444 AGGTCCCAGTCACCCCAGAACGG - Intergenic
955207336 3:56908189-56908211 AGACACCAGTGACCCCGAGCGGG + Intronic
955461713 3:59190143-59190165 AGCTCACTGTGTCCCCAAGCAGG - Intergenic
956821970 3:72962088-72962110 GGGCTCCAGTGACCCCAGGCAGG - Intronic
959212837 3:103410413-103410435 AGGTCGCAGGCACCCCAACCTGG + Intergenic
959595217 3:108122143-108122165 AGGTGCCAGTGACACCCAGGTGG - Intergenic
960057987 3:113289620-113289642 AGGCCCCGGTGACCCCCACCTGG + Exonic
960574696 3:119218258-119218280 AGTTCCCAGTGTCCCCCTGCAGG - Intronic
962345852 3:134618554-134618576 AGTTCCCAGTGACTCAAAACAGG - Intronic
964143952 3:153435959-153435981 AGGTCCCATGAAGCCCAAGCTGG - Intergenic
965329334 3:167351488-167351510 AGGTCCCAGTGACCCCAAGCAGG - Intronic
966354379 3:179063966-179063988 ACATCCCAGTGTTCCCAAGCTGG - Intronic
967775688 3:193383665-193383687 AGTTCTCTGTGACCCCAAGCAGG - Intergenic
968521554 4:1036754-1036776 AGGTCCCAGTGCTCCCTGGCAGG + Intergenic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968967701 4:3777386-3777408 GGGGCCCAGTGAGACCAAGCAGG - Intergenic
970380374 4:15501348-15501370 AGGTGCCAGGGACCCCAGTCAGG - Intronic
972341959 4:38159797-38159819 AGGGCCTAGTGCCCCCAATCAGG - Intergenic
978476456 4:109136732-109136754 AGGCCTCAGTGACCCCCAGCTGG + Intronic
979287500 4:118942359-118942381 AAGTGCCAGAGACCCCATGCCGG - Intronic
987033223 5:13994854-13994876 TGTTCCCAGTGAACCTAAGCAGG - Intergenic
987238873 5:15972181-15972203 TGGTCCTAGTGACTCCAACCAGG + Intergenic
988162930 5:27544324-27544346 AGGTCACACTGACCCAAAGGTGG - Intergenic
988377347 5:30454306-30454328 AGAACCCAGTGAACACAAGCTGG - Intergenic
997472733 5:134125678-134125700 AGGACACAGTGGCCCCAAGGAGG + Intronic
998928046 5:147148921-147148943 AGCTCCCAGTGCCCCAAGGCAGG - Intergenic
1000184227 5:158843476-158843498 AGATCCCTGTTACCCTAAGCTGG + Intronic
1000377737 5:160599029-160599051 AGCTCCCAGAGGTCCCAAGCAGG - Intronic
1001242533 5:170081380-170081402 ATGTCTCTGTGACGCCAAGCTGG + Intronic
1002467548 5:179415175-179415197 AGGCCCAAGTGACCCCACACTGG - Intergenic
1003336132 6:5174522-5174544 AGGTCCTAGTGACACCAAACAGG - Intronic
1006187135 6:32187942-32187964 TGGGCCCAGGGACCCCAGGCTGG - Intronic
1007581594 6:42963267-42963289 AGGGTCCAGTGGCCCCAAGGTGG + Intronic
1008005102 6:46402191-46402213 AGTGCCCAGTGACTCCATGCCGG - Intronic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1018004546 6:159609431-159609453 TGGTCACAGTCACCCCCAGCTGG + Intergenic
1018027891 6:159819864-159819886 AGGAACCAGTGCCCCCCAGCTGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020112117 7:5453129-5453151 ACCACCCAGTGACCCCCAGCAGG - Intronic
1022117845 7:27277820-27277842 AGGTCCTTGGGATCCCAAGCTGG + Intergenic
1022505844 7:30908288-30908310 TGGTCCCAGTGAGCCCTAGGAGG - Intergenic
1024118832 7:46217197-46217219 AGGTTGCAGTGAACCCAAGATGG - Intergenic
1024407696 7:49001631-49001653 AGCTCCAAGTGTCCCAAAGCAGG - Intergenic
1027417738 7:77990688-77990710 AGCTCGCTGGGACCCCAAGCAGG - Intergenic
1031829682 7:126611243-126611265 AGCTCCTAGTGACCTCGAGCAGG + Intronic
1034501744 7:151455135-151455157 AGGTCCTTGGAACCCCAAGCCGG - Intergenic
1037742186 8:21616620-21616642 ATGCCCCAGTGACCTCTAGCTGG - Intergenic
1038418045 8:27412015-27412037 AGGTCTGAGGGACCCCAAACAGG + Intronic
1039258495 8:35744987-35745009 AGGTTGCAGTGAGCCCAAGATGG + Intronic
1039758725 8:40550671-40550693 AGGATGGAGTGACCCCAAGCAGG - Intronic
1040588774 8:48769844-48769866 AGGTCACAGTCACATCAAGCAGG - Intergenic
1043270711 8:78329733-78329755 GGGTCCCAGGGACCACAAGGAGG - Intergenic
1043811300 8:84744436-84744458 AGGTCCCATTGAAGCAAAGCAGG + Intronic
1047790523 8:128199011-128199033 CTTTGCCAGTGACCCCAAGCAGG + Intergenic
1049416554 8:142498068-142498090 GGGTCCCAGAGTTCCCAAGCAGG - Intronic
1049422938 8:142524885-142524907 AGAGGCCAGTGACCCCAGGCGGG - Intronic
1049789085 8:144464886-144464908 AGGTGCCATGGCCCCCAAGCCGG - Exonic
1057816020 9:98295587-98295609 AGGTTGCAGTGAGCCCAAGATGG - Intronic
1058005709 9:99911694-99911716 TAGTCCCAGTGACACCAAGGTGG - Intronic
1060146809 9:121260104-121260126 AGCTCCCTGAGACCCCAAGGGGG + Intronic
1061834609 9:133320642-133320664 AGTTCCCAGTGACCAGCAGCCGG - Intergenic
1062142483 9:134967240-134967262 ATGGCCCAGTGCCCCCAAGGAGG - Intergenic
1062495373 9:136829023-136829045 AGGTTCCAGTGCCCACAAACAGG - Intronic
1185446110 X:258706-258728 AGGTCCCAGAGACCCTCTGCTGG - Intergenic
1185639476 X:1579017-1579039 GGGTCCCAGTGACCACATTCAGG + Intergenic
1188310616 X:28612379-28612401 TGGTCCCAGGGACCCCGGGCGGG + Intronic
1193156758 X:78182847-78182869 AGCTCCCTGGGTCCCCAAGCAGG + Intergenic
1194802825 X:98292955-98292977 AGGTCCCAGAGAGCTCAAGTTGG - Intergenic
1197730587 X:129806031-129806053 TGAGACCAGTGACCCCAAGCAGG + Exonic