ID: 965336919

View in Genome Browser
Species Human (GRCh38)
Location 3:167437780-167437802
Sequence AATAATTTCTTTCTTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336919_965336922 -4 Left 965336919 3:167437780-167437802 CCTCTCCAAAGAAAGAAATTATT No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data
965336919_965336924 22 Left 965336919 3:167437780-167437802 CCTCTCCAAAGAAAGAAATTATT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336919 Original CRISPR AATAATTTCTTTCTTTGGAG AGG (reversed) Intergenic
No off target data available for this crispr