ID: 965336920

View in Genome Browser
Species Human (GRCh38)
Location 3:167437785-167437807
Sequence AAAGGAATAATTTCTTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336920_965336924 17 Left 965336920 3:167437785-167437807 CCAAAGAAAGAAATTATTCCTTT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data
965336920_965336922 -9 Left 965336920 3:167437785-167437807 CCAAAGAAAGAAATTATTCCTTT No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336920 Original CRISPR AAAGGAATAATTTCTTTCTT TGG (reversed) Intergenic
No off target data available for this crispr