ID: 965336922

View in Genome Browser
Species Human (GRCh38)
Location 3:167437799-167437821
Sequence TATTCCTTTTCTCAGGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336918_965336922 18 Left 965336918 3:167437758-167437780 CCAATTCAGGAGATTTTATAAGC No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data
965336919_965336922 -4 Left 965336919 3:167437780-167437802 CCTCTCCAAAGAAAGAAATTATT No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data
965336920_965336922 -9 Left 965336920 3:167437785-167437807 CCAAAGAAAGAAATTATTCCTTT No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data
965336917_965336922 19 Left 965336917 3:167437757-167437779 CCCAATTCAGGAGATTTTATAAG No data
Right 965336922 3:167437799-167437821 TATTCCTTTTCTCAGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336922 Original CRISPR TATTCCTTTTCTCAGGTCTT TGG Intergenic