ID: 965336923

View in Genome Browser
Species Human (GRCh38)
Location 3:167437803-167437825
Sequence AAAGCCAAAGACCTGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336923_965336925 20 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336925 3:167437846-167437868 GGCAGACTCTGAGATGAAGCAGG No data
965336923_965336926 21 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336926 3:167437847-167437869 GCAGACTCTGAGATGAAGCAGGG No data
965336923_965336924 -1 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336923 Original CRISPR AAAGCCAAAGACCTGAGAAA AGG (reversed) Intergenic
No off target data available for this crispr