ID: 965336924 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:167437825-167437847 |
| Sequence | TTCAGTTGTACTGCGTGATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965336923_965336924 | -1 | Left | 965336923 | 3:167437803-167437825 | CCTTTTCTCAGGTCTTTGGCTTT | No data | ||
| Right | 965336924 | 3:167437825-167437847 | TTCAGTTGTACTGCGTGATGTGG | No data | ||||
| 965336919_965336924 | 22 | Left | 965336919 | 3:167437780-167437802 | CCTCTCCAAAGAAAGAAATTATT | No data | ||
| Right | 965336924 | 3:167437825-167437847 | TTCAGTTGTACTGCGTGATGTGG | No data | ||||
| 965336920_965336924 | 17 | Left | 965336920 | 3:167437785-167437807 | CCAAAGAAAGAAATTATTCCTTT | No data | ||
| Right | 965336924 | 3:167437825-167437847 | TTCAGTTGTACTGCGTGATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965336924 | Original CRISPR | TTCAGTTGTACTGCGTGATG TGG | Intergenic | ||
| No off target data available for this crispr | |||||