ID: 965336924

View in Genome Browser
Species Human (GRCh38)
Location 3:167437825-167437847
Sequence TTCAGTTGTACTGCGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336923_965336924 -1 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data
965336919_965336924 22 Left 965336919 3:167437780-167437802 CCTCTCCAAAGAAAGAAATTATT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data
965336920_965336924 17 Left 965336920 3:167437785-167437807 CCAAAGAAAGAAATTATTCCTTT No data
Right 965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336924 Original CRISPR TTCAGTTGTACTGCGTGATG TGG Intergenic
No off target data available for this crispr