ID: 965336925

View in Genome Browser
Species Human (GRCh38)
Location 3:167437846-167437868
Sequence GGCAGACTCTGAGATGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336923_965336925 20 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336925 3:167437846-167437868 GGCAGACTCTGAGATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336925 Original CRISPR GGCAGACTCTGAGATGAAGC AGG Intergenic