ID: 965336925 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:167437846-167437868 |
| Sequence | GGCAGACTCTGAGATGAAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965336923_965336925 | 20 | Left | 965336923 | 3:167437803-167437825 | CCTTTTCTCAGGTCTTTGGCTTT | No data | ||
| Right | 965336925 | 3:167437846-167437868 | GGCAGACTCTGAGATGAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965336925 | Original CRISPR | GGCAGACTCTGAGATGAAGC AGG | Intergenic | ||