ID: 965336926

View in Genome Browser
Species Human (GRCh38)
Location 3:167437847-167437869
Sequence GCAGACTCTGAGATGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965336923_965336926 21 Left 965336923 3:167437803-167437825 CCTTTTCTCAGGTCTTTGGCTTT No data
Right 965336926 3:167437847-167437869 GCAGACTCTGAGATGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965336926 Original CRISPR GCAGACTCTGAGATGAAGCA GGG Intergenic