ID: 965337588

View in Genome Browser
Species Human (GRCh38)
Location 3:167446449-167446471
Sequence GAGCCAGACTCATGATCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965337588 Original CRISPR GAGCCAGACTCATGATCACA GGG Exonic
901291474 1:8127589-8127611 GAAACAGTCTCATAATCACAGGG - Intergenic
903192942 1:21667009-21667031 GACCCAGACACAGGAACACACGG - Intronic
904517735 1:31069674-31069696 GAGCTGGACTCATGCTCTCAAGG - Intergenic
911497561 1:98650182-98650204 GGTCCAGCCTCAGGATCACAGGG - Intergenic
920048917 1:203151617-203151639 GCGCCAGCCTCATCCTCACAGGG + Intronic
922068458 1:222167363-222167385 GAGTCAGACTCACGCTAACAGGG - Intergenic
922616109 1:226962092-226962114 GAGCCAGGCTGATGGACACATGG - Intronic
1064103995 10:12485836-12485858 GAGACAGACGCATACTCACAGGG - Intronic
1067076443 10:43188217-43188239 GAATCAGACTCATGCACACAGGG - Intergenic
1068218110 10:54009865-54009887 GAGCCATACTCAGGCACACAGGG + Intronic
1071789726 10:88941301-88941323 GATCCAGACGCATGATGGCATGG + Exonic
1073824636 10:107305978-107306000 GAGCCTGGCTCATGGTCTCAGGG + Intergenic
1075201652 10:120409502-120409524 GAGCCAGACATATGTGCACACGG - Intergenic
1075465380 10:122646899-122646921 AGGGCAGACTCATGGTCACAGGG - Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081477946 11:43453949-43453971 CAGTCAGCCACATGATCACAAGG - Intronic
1081800515 11:45855861-45855883 CAGGCAGCCTCATGATCACTAGG - Intronic
1085768580 11:79305726-79305748 CAGCCAGACTGATTATCTCAAGG - Intronic
1086438184 11:86801574-86801596 GTGCCAGAATCCTCATCACATGG + Intronic
1090075736 11:123579041-123579063 GATCCTGAATCATGATCAGAGGG + Intronic
1091292517 11:134449726-134449748 AAGCCAGTCACATGAGCACAGGG - Intergenic
1092541521 12:9422449-9422471 TAGGCAGGCTCATGATTACAGGG - Intergenic
1098301233 12:69056078-69056100 GACCCAGCCTCATGTTCAAAGGG - Intergenic
1098504749 12:71236624-71236646 GAGTCACACTCTTCATCACAAGG + Intronic
1098743027 12:74199740-74199762 GAGACCCATTCATGATCACATGG + Intergenic
1103726852 12:123001562-123001584 AAGCCAGACACAAGACCACATGG - Intronic
1103800046 12:123532350-123532372 CAGAGAGACTCCTGATCACAGGG + Intronic
1103888738 12:124222645-124222667 CAGCCAGCCTCTTGATCAGATGG + Intronic
1106020364 13:25908776-25908798 GAACCAGGATCATGAGCACAGGG - Intronic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1114352362 14:21866949-21866971 TTGCCAGACTCATTATCAAAGGG - Intergenic
1120530614 14:85626509-85626531 GAGGCATAGTCATGATCAAAAGG + Exonic
1123585786 15:21759716-21759738 CAGCAAGACTCAGGACCACAAGG - Intergenic
1123622428 15:22202304-22202326 CAGCAAGACTCAGGACCACAAGG - Intergenic
1124126329 15:26941099-26941121 GAGGCAGAGTGATGATCAGACGG - Intronic
1125003141 15:34792480-34792502 GATCCAGACGCATGATGGCATGG + Exonic
1125855405 15:42944294-42944316 GACACAGACTATTGATCACATGG + Exonic
1132495281 16:260256-260278 CAGCCACCCTCAAGATCACAGGG - Intronic
1132852638 16:2031637-2031659 CAGCCAGACTCATGCACAAAGGG - Intronic
1136179721 16:28542774-28542796 GAGAGAGTTTCATGATCACAGGG + Intergenic
1138599124 16:58044833-58044855 GAGCCAGACTGAGGCTCAGAGGG - Intronic
1138648727 16:58444720-58444742 GAGCCAGATCCAAGAGCACAGGG - Intergenic
1139201867 16:64985922-64985944 GAGGCAGAGTCTTGACCACAGGG - Intronic
1140071517 16:71654533-71654555 CAGCCAGCCACTTGATCACAAGG + Intronic
1141188318 16:81804927-81804949 TACCCATACACATGATCACATGG - Intronic
1141935663 16:87236367-87236389 GAGCCAGAGGCAGGACCACAGGG - Intronic
1144440362 17:15275894-15275916 GAGCCACAGTCTTGATGACAAGG + Intergenic
1144672767 17:17142306-17142328 GAGCCACAGACATGATCAAAAGG - Intronic
1146362945 17:32193893-32193915 GAACCAGATTCATGAACATACGG - Intronic
1146631500 17:34473481-34473503 CACCCAGTCTCAGGATCACAGGG + Intergenic
1150668935 17:67172322-67172344 GAGGCAGACTCATAAATACAGGG - Intronic
1150957168 17:69871907-69871929 GAGACAGATTCATGATCGTAGGG - Intergenic
1155634390 18:27935305-27935327 GAAGCAGACACATGTTCACATGG + Intergenic
1157057703 18:44250226-44250248 GAGCCGGAGTTATGATCCCAGGG + Intergenic
1157644748 18:49256231-49256253 AAGTCAGAATCATAATCACAAGG - Intronic
1159443460 18:68510502-68510524 GAGGTAGACTCGTTATCACAGGG + Intergenic
1165180468 19:33963179-33963201 GAGTCAGACTCAAGCCCACAGGG + Intergenic
925191447 2:1887632-1887654 GAGCCACACGGATGATCACATGG + Intronic
925570351 2:5303907-5303929 GAGACAGACACAAGATCACTTGG + Intergenic
928593375 2:32839097-32839119 GAGCCAGGGTCCTGGTCACAGGG + Intergenic
929114622 2:38433858-38433880 GAGACAGACTCATGAACACATGG + Intergenic
931118952 2:59195542-59195564 GAGCCTGACTGATGATGACTTGG + Intergenic
934255060 2:91405008-91405030 GAACCAGAGTCATCATCAAATGG + Intergenic
934256056 2:91418340-91418362 GAACCAGAGTCATCATCAAATGG - Intergenic
935902408 2:107806602-107806624 CAGCCAGATTCTTTATCACAGGG + Intergenic
939597383 2:144143019-144143041 CAGTCAGCCACATGATCACAAGG + Intronic
939706927 2:145466489-145466511 GAGCGCAACTTATGATCACATGG - Intergenic
939919688 2:148094045-148094067 GAGACATGCCCATGATCACATGG + Intronic
941704712 2:168645586-168645608 GAGGTAAACTCATTATCACAGGG + Intronic
943992698 2:194717438-194717460 TAGTCAGCCACATGATCACAAGG + Intergenic
1169883870 20:10376294-10376316 GATCCAGCCTTCTGATCACACGG + Intergenic
1170447404 20:16442792-16442814 GAGCCAGTATCATTATCAGAAGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1173149599 20:40554843-40554865 CAGCCAGGATCATGATGACATGG + Intergenic
1173575530 20:44110907-44110929 GAGCCAGGCTCCTGAGGACAGGG + Intergenic
1174593602 20:51666328-51666350 GGGCCAGAGTCAGGAGCACAAGG - Intronic
1174716279 20:52762170-52762192 GATCCAGTCTCATGAACAAATGG - Intergenic
1178305950 21:31490199-31490221 GACCCCAAGTCATGATCACAGGG - Intronic
1178570011 21:33727442-33727464 GAGCCAGACACATGAAGGCAAGG + Intronic
949564541 3:5232676-5232698 GAGCCAGAGGCCTGAGCACACGG - Intergenic
949782962 3:7710732-7710754 GACCCAAACTCATCAGCACAGGG + Intronic
953004357 3:38964260-38964282 AAGCCAGACTCCTCATCAGACGG - Intergenic
954129157 3:48551007-48551029 GACCCAGACTGATGCCCACAAGG + Intronic
956091759 3:65675007-65675029 GAGCCAGCCCCATGAACACTTGG - Intronic
963102525 3:141620767-141620789 GAGCCAGTCTCATGAAGAGATGG - Intergenic
964505164 3:157391194-157391216 GAGCCAGCCCAATGGTCACAAGG + Intronic
965337588 3:167446449-167446471 GAGCCAGACTCATGATCACAGGG + Exonic
965482461 3:169236051-169236073 CAGTCAGCCACATGATCACAAGG + Intronic
973206682 4:47568964-47568986 GAGCTGGACTCATTATCACTGGG + Exonic
974473435 4:62349010-62349032 GAGGCAGACTCAGCAGCACAGGG + Intergenic
977862460 4:101980682-101980704 GAGAAAGACTCAACATCACAAGG - Intronic
983965024 4:173799300-173799322 GAGCAAGACTCCTCATCAAAAGG - Intergenic
984290516 4:177788597-177788619 GAGCAAAACTCATTACCACAAGG - Intronic
987251969 5:16109278-16109300 GAACCAACCTCATGATTACAGGG + Intronic
988004917 5:25397180-25397202 GAGCCAGAGACAGGATCACATGG + Intergenic
991746964 5:69752920-69752942 TAGCCGGACACATGATCACCAGG - Intergenic
991750741 5:69802322-69802344 TAGCCGGACACATGATCACCAGG + Intergenic
991798566 5:70332862-70332884 TAGCCGGACACATGATCACCAGG - Intergenic
991826341 5:70628232-70628254 TAGCCGGACACATGATCACCAGG - Intergenic
991830030 5:70677219-70677241 TAGCCGGACACATGATCACCAGG + Intergenic
991890897 5:71332185-71332207 TAGCCGGACACATGATCACCAGG - Intergenic
991957129 5:72006190-72006212 GAGCCATACTGATCATCATAAGG + Intergenic
995359846 5:111282957-111282979 CAGTCAGCCACATGATCACAAGG - Intronic
996336933 5:122394289-122394311 GAACCAGGCTCATGACCAGAGGG - Intronic
997442507 5:133918826-133918848 GAGCCAGACCCATCTCCACAGGG + Intergenic
997902208 5:137777423-137777445 GTTCCAGACTCATCAACACAAGG + Intergenic
998348636 5:141486299-141486321 GATCCAGACTCAGGGTCAAACGG + Exonic
1009350726 6:62674704-62674726 GAGCCAGATTCATGGTCATTTGG - Intergenic
1014734415 6:125075533-125075555 GAGACTCACTCATTATCACAAGG + Intronic
1015256999 6:131189108-131189130 CAGCCAGTCACAGGATCACAAGG - Intronic
1015733471 6:136372350-136372372 TAGCCAGATTCATGATCAATGGG + Intronic
1017076835 6:150626417-150626439 GAGACAGACTCCTGATCCCGAGG - Intronic
1020233624 7:6339101-6339123 TAGGCTGAATCATGATCACAAGG + Intronic
1021544318 7:21796048-21796070 GAGGCAGGGACATGATCACACGG + Intronic
1023666154 7:42525412-42525434 GAGTCAGACTCTTTATCACACGG + Intergenic
1026290582 7:69002353-69002375 GAAACAGTCTAATGATCACAGGG + Intergenic
1030609886 7:111678001-111678023 GAGCTAGAGTCCAGATCACAAGG + Intergenic
1032103666 7:129005622-129005644 GAAGCAGACACATGTTCACACGG - Intronic
1033563734 7:142558780-142558802 CAGACAGATGCATGATCACATGG - Intergenic
1033564113 7:142562091-142562113 GAGACAGATGCATGATCACATGG - Intergenic
1035322208 7:158039390-158039412 GAGACAGAGACCTGATCACAGGG + Intronic
1036986557 8:13538247-13538269 GAGCCACACTCAATATCAGAGGG - Intergenic
1038417750 8:27409588-27409610 GACCCAAACTAATGAACACAAGG - Intronic
1038717791 8:30007525-30007547 GTGCCAGACTGATGATTAGAGGG + Intergenic
1042615494 8:70644206-70644228 TGGCCACACTGATGATCACATGG - Exonic
1045357771 8:101404705-101404727 GAGCCAGGCTCAGGATAACTTGG - Intergenic
1050147922 9:2589805-2589827 GAGCTAGAATCATGATGACAAGG + Intergenic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1050647403 9:7735325-7735347 AACACAGACTGATGATCACATGG - Intergenic
1053315255 9:37045639-37045661 CAGTCAGCCCCATGATCACAGGG - Intergenic
1060228795 9:121812370-121812392 GAGCCCGGCTCATGAACGCAGGG + Intergenic
1060478374 9:124001354-124001376 GAGCCAGACTCAGGATTAACCGG - Intergenic
1060793857 9:126502169-126502191 AAGGCAGCCTCATGGTCACATGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1200410848 Y:2860003-2860025 GAGCATGACTCATCATCAGATGG + Intronic