ID: 965338307

View in Genome Browser
Species Human (GRCh38)
Location 3:167455425-167455447
Sequence CTGGGGATAAGGGGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 6, 2: 5, 3: 93, 4: 823}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965338307_965338316 22 Left 965338307 3:167455425-167455447 CCTTCCTTTCCCCTTATCCCCAG 0: 1
1: 6
2: 5
3: 93
4: 823
Right 965338316 3:167455470-167455492 GTCTTGGATCAATTTCCCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 122
965338307_965338317 23 Left 965338307 3:167455425-167455447 CCTTCCTTTCCCCTTATCCCCAG 0: 1
1: 6
2: 5
3: 93
4: 823
Right 965338317 3:167455471-167455493 TCTTGGATCAATTTCCCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 174
965338307_965338315 6 Left 965338307 3:167455425-167455447 CCTTCCTTTCCCCTTATCCCCAG 0: 1
1: 6
2: 5
3: 93
4: 823
Right 965338315 3:167455454-167455476 TGTTTAATGAAAAAAAGTCTTGG 0: 1
1: 1
2: 3
3: 65
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965338307 Original CRISPR CTGGGGATAAGGGGAAAGGA AGG (reversed) Intronic
900485092 1:2918954-2918976 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
900534616 1:3170695-3170717 CGGGGGAGCAGGGGAAGGGAGGG + Intronic
900573124 1:3369524-3369546 CTGGGTATGAGGAGAAAGGATGG + Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900638242 1:3676048-3676070 CTGGGGACAGGGGACAAGGAGGG + Intronic
900714076 1:4132958-4132980 CTGGGGCTGAGGGGTAAAGATGG + Intergenic
900727794 1:4229582-4229604 CTGGGGACTTGGGGAAAGGGTGG + Intergenic
900765470 1:4502102-4502124 CTGGGGAGAGGGGACAAGGAGGG - Intergenic
901123550 1:6913511-6913533 CTGGGGGCAGGGGGAAAGGGAGG - Intronic
901649753 1:10736843-10736865 ATGGGGACAAGGGGAAGGCAGGG + Intronic
901756768 1:11446146-11446168 CTCGGGACAAGAGGACAGGAGGG - Intergenic
902086670 1:13868190-13868212 CTGGGGAGACGGGGAAGTGATGG - Intergenic
902222122 1:14972999-14973021 CTGGGGATAATGTGAAGAGAAGG - Intronic
902361076 1:15942991-15943013 GTGGGGAGCAGGGGGAAGGAAGG - Intronic
902602437 1:17549438-17549460 CTGGGGATGAGGGGTAGAGAGGG + Intronic
902918119 1:19650993-19651015 CAGGGGATCATGGGAAAGGCTGG - Intronic
903010693 1:20328042-20328064 GTGGGGAGCAGAGGAAAGGAGGG + Intronic
903097511 1:20991826-20991848 CTTGGGAAAAGGGGAAAGGCAGG + Intronic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904466823 1:30713102-30713124 TTGGGGACCAGGGAAAAGGATGG - Exonic
905291393 1:36924088-36924110 GTGGGGCTAAGGGGCAGGGAGGG + Intronic
905397439 1:37675911-37675933 CAGGGGATAAGGCCACAGGAAGG + Intergenic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
905466542 1:38158530-38158552 CTGGGGATAAAGGACACGGATGG + Intergenic
905515377 1:38558533-38558555 CTGGGGAGAAGAGTAATGGAGGG - Intergenic
905642686 1:39602258-39602280 CATGGGTTAAGGGGAAGGGAGGG - Intergenic
905730148 1:40292333-40292355 CTTGGGATAAGAGGAATGGCAGG - Intronic
905880407 1:41459729-41459751 CTGGGGCTCAGAGGCAAGGATGG - Intergenic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
906141156 1:43534345-43534367 CTGTGGCTATGGGAAAAGGATGG + Intronic
906243168 1:44254857-44254879 CTGAGGAGGTGGGGAAAGGATGG - Intronic
906287546 1:44597352-44597374 GGGGGGAAAAGGGGCAAGGAGGG + Intronic
906802771 1:48751845-48751867 CTAGGGAGAAAGGGGAAGGAGGG + Intronic
907608101 1:55839891-55839913 CTCGGGATAAGGGTAGAGAAGGG - Intergenic
907724203 1:57003691-57003713 CTGGGGATTTGGGGAATGAATGG - Intronic
907923505 1:58934592-58934614 CTGGGGCTGGGGGGAATGGAAGG + Intergenic
907926142 1:58956802-58956824 CTGGGTATAGGGAGAAAGGAAGG - Intergenic
908254182 1:62289138-62289160 CTAGTGATAAGTGGAAAAGACGG + Intronic
908460674 1:64345890-64345912 CTTGGGATCAGGGAAAAGGAGGG - Intergenic
908511122 1:64850721-64850743 TTGGGGATCTGGGGGAAGGAAGG - Intronic
910480246 1:87650830-87650852 GTAGGGAAAAGGAGAAAGGAAGG - Intergenic
910488525 1:87742680-87742702 CTGGGACTAAGGGGACAGGCAGG + Intergenic
911044760 1:93619272-93619294 CTAGTGATAAGTGGAAAAGAGGG + Intronic
911049563 1:93659135-93659157 CTGGGGATAAGAGGGAATGAAGG + Intronic
911619470 1:100050527-100050549 GTGTAGATAAGGGGAATGGAAGG + Intronic
912328040 1:108787417-108787439 CTAGTGATAAGTGGAAAAGAGGG - Intronic
913706773 1:121433652-121433674 CTGGGGTGAAGGGGAAGTGAAGG - Intergenic
914756307 1:150563339-150563361 CTGGGGACAAGGGGAGAGCAAGG - Intergenic
915073805 1:153293077-153293099 CAGAGGGTAAGGGGGAAGGATGG + Intergenic
915328109 1:155091787-155091809 GTGGGGATAAGAGAAATGGACGG - Intergenic
915334101 1:155130457-155130479 CTTGGGAGGAGGGGAGAGGAGGG + Intronic
916039610 1:160950936-160950958 GTGGGGATATGGGGAAGGGCTGG - Intronic
916337506 1:163690070-163690092 TGGGGGTTAAGGGGATAGGAGGG + Intergenic
916415528 1:164588981-164589003 CTGGGGAGGAGGGGAGAGGCCGG - Intronic
916419290 1:164621344-164621366 TTGGGGATAAAAGAAAAGGAAGG - Intronic
916759103 1:167800785-167800807 ATGGGAATAAGAGGATAGGAGGG + Intergenic
917213982 1:172659212-172659234 CTGGGGATATGGGTAATTGAAGG - Exonic
917399990 1:174637119-174637141 ATGGGGAGAAGGGGCAGGGATGG - Intronic
917654932 1:177116895-177116917 CTGGGGAGGAGTGGAAAGCAAGG - Intronic
918259624 1:182783782-182783804 TTGGGCAAAAGGGAAAAGGAGGG + Intergenic
918792937 1:188854230-188854252 CTGGGGTTCAGGGAAAAGTAGGG - Intergenic
919131325 1:193454578-193454600 ATGGGGGTAAGAGGAGAGGAGGG + Intergenic
919217288 1:194574935-194574957 CTAGTGATAAGTGGAAAAGAGGG - Intergenic
919324890 1:196094555-196094577 CAGGGGGTGAGGGGAAAGGGTGG + Intergenic
919407595 1:197203950-197203972 CTGGGGATTCAGGGAAAGGGTGG - Intergenic
919443934 1:197677491-197677513 GTGGGGGTCAGGGAAAAGGAGGG - Intronic
919841780 1:201614494-201614516 ATGGGGGCGAGGGGAAAGGAAGG - Intergenic
919928042 1:202202836-202202858 CAAGGGCAAAGGGGAAAGGATGG - Intronic
920112734 1:203598611-203598633 CTGGGAATATGGGGAATGGGTGG - Intergenic
920303442 1:205003582-205003604 CTGGGGCTAAGGGTAAGGGTGGG + Intronic
920494193 1:206442473-206442495 ATGGGGATGAGGGGAAAACAGGG + Intronic
920817483 1:209348527-209348549 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
920963012 1:210680896-210680918 CTGGGTATGAGGGGCAAAGATGG - Exonic
921290074 1:213649128-213649150 CTGGGGATCATGGAAAGGGATGG - Intergenic
921951239 1:220932205-220932227 CTGGGGGTGGGGGGAAAGGGTGG + Intergenic
922061586 1:222097642-222097664 CCGGAGAGAAGGGGACAGGAGGG + Intergenic
922118997 1:222644041-222644063 CTGGGGAAAAGGAGAAAAGCAGG - Intronic
922213095 1:223500300-223500322 CTGGGGATTGGGGGGAATGATGG + Intergenic
922804016 1:228376624-228376646 CTGGGGGTATGGGGACAGGGAGG - Intronic
922963220 1:229665649-229665671 CAGGGAAAAAGGGGACAGGATGG - Intergenic
923017885 1:230140728-230140750 CTGAGGAAAAGGGGAAGGGAGGG - Intronic
923044474 1:230345434-230345456 CTGCAGATGAGGGGAGAGGAGGG + Intronic
923809011 1:237291751-237291773 CCAGGGATAAGGGGCAGGGAGGG + Intronic
924147139 1:241088128-241088150 CTGGGCATAGGGGAAAAGGAGGG + Intronic
924147263 1:241089129-241089151 CTGGGCATAGGGGAAAAGGAGGG + Intronic
924643351 1:245854649-245854671 GTGGGGATTAGAGAAAAGGAAGG - Intronic
924645228 1:245871495-245871517 CTGGGGAATAAGGAAAAGGAAGG + Intronic
1063877272 10:10493271-10493293 CTGGGGAGAGGGGGCATGGATGG + Intergenic
1064412787 10:15121770-15121792 CTGGGGGAAAGGGGAATGGGAGG + Intronic
1064443599 10:15373986-15374008 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
1065117359 10:22495773-22495795 CTGGAGACAAGGGGAAGGGATGG - Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065540843 10:26765615-26765637 CTGAGGAAGAGGGGAAGGGAAGG + Intronic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066687080 10:37991615-37991637 CTAGTGATAAGTGGAAAAGAAGG + Intergenic
1066700318 10:38120696-38120718 CTGGGGGTCAGGGGAAGGCATGG + Exonic
1066991376 10:42517537-42517559 CTGGGGGTCAGGGGAAGGCATGG - Intergenic
1067107334 10:43374898-43374920 CTGGGGACTAGGGAAAGGGAGGG - Intronic
1067113062 10:43414327-43414349 CTGGGGAAATGGGCAAAGTAAGG - Intergenic
1067485961 10:46650200-46650222 GAGGGGATAAGTGGAAAGAAGGG + Intergenic
1067488899 10:46679248-46679270 GTAGTGATAAGTGGAAAGGAGGG - Intergenic
1067558086 10:47286085-47286107 CTGGGGATGAGGGGAAAAGAGGG + Intergenic
1067578662 10:47425129-47425151 GTGGGGAAAAAGGGAAAGCAAGG - Intergenic
1067605769 10:47661128-47661150 GTAGTGATAAGTGGAAAGGAGGG + Intergenic
1067608795 10:47691453-47691475 GAGGGGATAAGTGGAAAGAAGGG - Intergenic
1069274888 10:66577496-66577518 TTGGGTATATGGTGAAAGGAAGG + Intronic
1069293629 10:66815314-66815336 CTGGGGATGAAGGGAGGGGATGG - Intronic
1069628112 10:69880621-69880643 CTGGGGATGAGGGGACAGCGAGG + Intronic
1069655038 10:70081453-70081475 CCAGGGAGAGGGGGAAAGGATGG + Intronic
1069807931 10:71137610-71137632 CTGGTAATGAGGGGACAGGAGGG - Intergenic
1069853754 10:71427306-71427328 CTGGGGGTAACGGGGAGGGAGGG - Intronic
1069890449 10:71649110-71649132 CTGGGGAGACTGGGAGAGGAAGG - Intronic
1069943819 10:71972801-71972823 AAGGGGAAAAGGGGGAAGGAGGG - Intronic
1070035778 10:72722371-72722393 CTGAGGTTAAGGGGAAAAGGTGG - Intronic
1070195607 10:74153552-74153574 CGTGGGATTAGGGGAAAGAAGGG + Intronic
1070362641 10:75705732-75705754 TGTGGGATGAGGGGAAAGGATGG - Intronic
1070589900 10:77794289-77794311 CTGGGCAGATGGGGGAAGGAGGG + Intronic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1071500862 10:86203491-86203513 CTGGGCATGAGGGGAAAGCCAGG + Intronic
1071605062 10:86980204-86980226 CTGGGGAGGAGGGGACAGGGAGG + Intronic
1071621328 10:87122487-87122509 GTAGTGATAAGTGGAAAGGAGGG + Intronic
1071624377 10:87153100-87153122 GAGGGGATAAGTGGAAAGAAGGG - Intronic
1071643662 10:87341759-87341781 CTGGGGATTTGGGGAGACGATGG + Intergenic
1071956711 10:90768294-90768316 CTGAGGATAATGGGTTAGGAAGG - Intronic
1072534635 10:96352816-96352838 CTGGAGCGAAGGAGAAAGGAGGG - Intronic
1072551699 10:96483253-96483275 CTAAGAATAAGGGAAAAGGAAGG + Intronic
1073062031 10:100738963-100738985 CTCGGGGAAAGGGGGAAGGAGGG - Intronic
1073178801 10:101571533-101571555 CTTCAGATAAGGGGGAAGGAGGG + Intronic
1073203924 10:101758571-101758593 CTGGGGATGAGGGCAAAGAGAGG - Intergenic
1073204095 10:101759574-101759596 CGGGGGAAGAGGGGAAGGGAGGG + Intergenic
1073431735 10:103491654-103491676 CTGGGGCTATGGGCAAAGCAGGG - Intergenic
1073704514 10:105968065-105968087 CTGAGTATAAGGTGAAAGCAGGG + Intergenic
1074424291 10:113337659-113337681 CTGGGGATAAGAGTATGGGATGG - Intergenic
1074424387 10:113338238-113338260 GTGGGGAGGAGGGGAAGGGAGGG + Intergenic
1074430179 10:113387575-113387597 CTGGGGATTTGGGGAAAGTCTGG + Intergenic
1074499507 10:114010939-114010961 CTGGGGAGAGGGGGAAATGGGGG - Intergenic
1074781357 10:116804521-116804543 CTGGGGGTAAAGGGAGAGGAAGG - Intergenic
1074832831 10:117261756-117261778 CGGGGGAGAGGGGGTAAGGATGG + Intronic
1075321913 10:121498289-121498311 CTGGGGGCCAGTGGAAAGGAGGG - Intronic
1075437341 10:122454759-122454781 CTGAGGCGGAGGGGAAAGGAGGG + Exonic
1075833339 10:125429852-125429874 CTGAGAATGAGTGGAAAGGAAGG - Intergenic
1076357470 10:129863793-129863815 CTGGGGAGCAGAGGAAAGGTAGG - Intronic
1076394451 10:130128856-130128878 CTTGGGCTAAGGAGAAGGGACGG + Intergenic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076668351 10:132105338-132105360 ATGGGAATAAAGGAAAAGGATGG + Intronic
1077092362 11:785035-785057 CCGGGGTTAAGGGGAGGGGACGG + Intergenic
1077532203 11:3102659-3102681 CTGAGGCTCAGGTGAAAGGATGG - Intronic
1077595341 11:3527046-3527068 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1077871844 11:6269589-6269611 TTGGGGATAAGACGGAAGGAGGG + Intronic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078053559 11:7987813-7987835 TTGGGGATGGGAGGAAAGGACGG - Intronic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1078727879 11:13948056-13948078 CTGGTGATAAATGGAAAAGAGGG - Intergenic
1078857139 11:15215464-15215486 CTGGGGAGAAGAGGAAAAGCTGG - Intronic
1078948776 11:16103859-16103881 TTGGGGATTGGGGGAAAGGTTGG + Intronic
1079090544 11:17477080-17477102 CTGGGGGAGAGGGGAAAGGCAGG + Intergenic
1079318458 11:19430126-19430148 GTGGGGGTAAGGGGACAGGTGGG - Intronic
1079656798 11:22995081-22995103 CTGGGGAAAAGAGGAAAAGGAGG + Intergenic
1079855930 11:25605075-25605097 TTGGGGACTTGGGGAAAGGATGG - Intergenic
1079944845 11:26729247-26729269 CTAGTGATAAGTGGAAAAGAAGG - Intergenic
1080242918 11:30147542-30147564 GTGGGGAGGAGGGGAAAAGAGGG - Intergenic
1081484918 11:43520198-43520220 CAGGTGATGAGGGGACAGGAAGG - Intergenic
1081661662 11:44892209-44892231 CTGGTGATCTGGGGAAAGGCAGG - Intronic
1081759864 11:45569672-45569694 CTGGGGAGGAGGGGAAGGGAGGG + Intergenic
1081896719 11:46593496-46593518 GGGGGGAAAAGGAGAAAGGAAGG + Intronic
1081952879 11:47060635-47060657 TTGGGGACCCGGGGAAAGGATGG + Intronic
1082763473 11:57148421-57148443 CTGGGGGTATGGGGAAGGCAGGG - Intergenic
1082775647 11:57242481-57242503 CTGAGGGAAAGGGGAAGGGAGGG + Intergenic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1082835709 11:57648977-57648999 CTGGGAATTAGGGGAGAGGGAGG - Exonic
1082898056 11:58214036-58214058 GTGGGGATAGAGGGAAAAGATGG - Intergenic
1083079627 11:60077160-60077182 CTGGGGAGCAGGGGACGGGAGGG + Intergenic
1083186057 11:61018481-61018503 AAGGGGAAAAGGAGAAAGGAAGG + Intronic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083562702 11:63685960-63685982 ATGGGGATCAGGGGTCAGGATGG + Intronic
1083615409 11:64023701-64023723 CAGGGGAGTCGGGGAAAGGAGGG - Intronic
1084361235 11:68669809-68669831 CTGGGGAAAAGGGGTCAGGGTGG - Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084821603 11:71695013-71695035 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1085156677 11:74301957-74301979 CTGGGTAGAAAGGGAAAGCAGGG - Intronic
1085404135 11:76251743-76251765 CTGGGGGAATGGGGAAATGAGGG + Intergenic
1085596720 11:77818372-77818394 GTGGGCATTTGGGGAAAGGATGG - Intronic
1085659322 11:78349010-78349032 CTGGGGCTAAGGGCAAAGGAAGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086324133 11:85681265-85681287 ATGGGTATCTGGGGAAAGGAGGG + Intronic
1086404105 11:86485679-86485701 CTGGGTAAAAGGGGAGAGAATGG - Intronic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1088163150 11:106898687-106898709 CTGGGGTTAAGGGGTAGGGAAGG + Intronic
1088756062 11:112886398-112886420 CAGGTGATAAGGGGAGGGGACGG - Intergenic
1089231407 11:116980342-116980364 CTAGTGATAAGCGGAAAAGAGGG - Intronic
1089346121 11:117792857-117792879 CTGGGGATATTGGGGTAGGATGG - Intronic
1089459072 11:118642214-118642236 GAGGGGAAAAGGGGACAGGAGGG - Intronic
1089474911 11:118751822-118751844 CTGGGGAAAGGGGACAAGGAAGG - Exonic
1089517920 11:119045438-119045460 GTGTGGAGAAGGGGAAGGGAGGG - Exonic
1089790441 11:120939317-120939339 TTGGAGGCAAGGGGAAAGGAAGG + Intronic
1089912227 11:122112534-122112556 CTGGGTCTAATGGGACAGGAAGG + Intergenic
1090062615 11:123477235-123477257 AGGGGGAGAAGGGGAGAGGATGG - Intergenic
1090630852 11:128645999-128646021 CTGGGGATATGGGGCAAGTGGGG + Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091295280 11:134469768-134469790 CTGGGGAAAAGAGAAAAGGCGGG + Intergenic
1091356113 11:134938863-134938885 CTAGTGATAAGTGGAAAAGAGGG - Intergenic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091723024 12:2827057-2827079 CTGGGGAAAATGGGACAGCAGGG + Exonic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1091841611 12:3625460-3625482 CTGGGATTAATGGGAATGGATGG - Intronic
1091913881 12:4253476-4253498 GTGGGCAGAAGTGGAAAGGAAGG - Intergenic
1092033003 12:5305526-5305548 CTGGGGACAAAGGGAGAGGCAGG - Intergenic
1092041900 12:5392788-5392810 ATGGGGAGAAGAGGAGAGGAAGG - Intergenic
1092421498 12:8335820-8335842 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093618964 12:21264543-21264565 CTAGGGAAGAGGAGAAAGGAAGG + Intergenic
1093625314 12:21339742-21339764 TTGTGGAGAAGGGGAAAGCAAGG - Intronic
1093711367 12:22333797-22333819 CTGGGGATCAGGGGTGGGGAAGG + Intronic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1095265047 12:40146034-40146056 CTGGGGGTGAGGGGAAAGCTTGG + Intergenic
1096120847 12:49088696-49088718 CTGGTGATAATGGGAGAGGGAGG + Intergenic
1096237490 12:49939723-49939745 CTGGGGTGAAGGGCATAGGATGG - Intergenic
1096240297 12:49956207-49956229 CTCAGGAGAAGGGGAAGGGAAGG + Exonic
1096498030 12:52050033-52050055 CATGGGAGAAGGGGAATGGATGG + Intronic
1096790898 12:54044230-54044252 CTGGGGAAGGGAGGAAAGGAGGG - Intronic
1096974029 12:55688347-55688369 CAGGAGGTAAGGGGAAGGGAGGG - Intronic
1098529106 12:71520391-71520413 CTGGAAATAAGGGGAATGGAGGG + Intronic
1100165011 12:91907143-91907165 ATGGGGATAAGTGGATAGAAGGG + Intergenic
1100559466 12:95733730-95733752 CTGGGGAGAAGGGGAAACATGGG + Intronic
1100873672 12:98939999-98940021 CTGGGGAAAAGGGCACAGGGAGG + Intronic
1101465438 12:104944191-104944213 CTGGGGATAGGGGAAAGAGAAGG - Intronic
1101567599 12:105922944-105922966 CTGGGGACTAGGGGAGATGAGGG + Intergenic
1101949330 12:109162433-109162455 CTGGAGCTGAGGGGTAAGGAGGG + Intronic
1102237633 12:111304187-111304209 CTGGGGAGAAGGGGACAGTGTGG - Intronic
1102601107 12:114031299-114031321 CAGGGCAGAAGGGAAAAGGAAGG - Intergenic
1103088539 12:118080864-118080886 CTGGGGAAAAGAGGGAATGAGGG + Intronic
1103111848 12:118287053-118287075 TTGGGGACTCGGGGAAAGGACGG + Intronic
1103452193 12:121037061-121037083 CTGGGGATAGGTGCAAAGAACGG + Intronic
1103483643 12:121267861-121267883 CTGGGGAACAGGGGAAATGAGGG - Intronic
1104235788 12:126935234-126935256 GTGGGGAGAAGGGGACAGTAAGG + Intergenic
1104618641 12:130292592-130292614 CTGGGGAGCAGGGGAAGAGATGG + Intergenic
1106192997 13:27470450-27470472 CTAGGGTTAAGGAGAAGGGAGGG + Intergenic
1107976220 13:45691178-45691200 TTGGGGAAAAGGGGATGGGAAGG - Intergenic
1108107540 13:47027945-47027967 CTGGAGATAATCAGAAAGGATGG - Intergenic
1108158186 13:47610141-47610163 CTAGGGAGAAGGGGTAAGAAAGG + Intergenic
1109261033 13:60145192-60145214 CTGGGGACTGAGGGAAAGGAAGG - Intronic
1109722851 13:66298429-66298451 CTGAGGATAGGGGGAAATGGGGG + Intergenic
1110189351 13:72713617-72713639 TTGGGGAACAGGGGGAAGGATGG - Intronic
1110628056 13:77673966-77673988 TTGGGGATTTGGGGGAAGGACGG + Intergenic
1110826934 13:79981826-79981848 CAGGGGTTAGTGGGAAAGGAGGG - Intergenic
1111295902 13:86277524-86277546 CTGGGGAAATGGGACAAGGAAGG + Intergenic
1111956188 13:94761207-94761229 ATGGGGAGAAAGGGGAAGGAAGG - Intergenic
1112197244 13:97237972-97237994 CTGGGGCCAAGGGAAAGGGAGGG + Intronic
1112347274 13:98600604-98600626 CTAGGGCTAGGGGGAAAGAATGG + Intergenic
1112376619 13:98848275-98848297 CTGGGGAGAAGAGGATGGGAAGG + Intronic
1112395560 13:99027517-99027539 CTGGGGATAAGGGAACCGCAAGG + Intronic
1113637073 13:111926980-111927002 GTGTGGAGAAAGGGAAAGGACGG + Intergenic
1114050758 14:18918662-18918684 CCAGGGAGAAGGGGAAAAGACGG - Intergenic
1114111801 14:19483260-19483282 CCAGGGAGAAGGGGAAAAGACGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114525815 14:23366303-23366325 CTGGGGATTAAGAGAAAGGAGGG + Intergenic
1114570660 14:23665227-23665249 CTGGGAATAGGGGGAGAAGAAGG - Intergenic
1116636502 14:47403101-47403123 CTAGGAATAAGAGGAAAAGAAGG - Intronic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1117299630 14:54412011-54412033 ATGGTGATGAGGGGAAAGGAGGG - Intronic
1117366268 14:55031627-55031649 GTGGGGAGAAAGGGAAAGGAGGG + Intronic
1117851199 14:59971725-59971747 GTGGGGATAATGGAAAAGGGAGG - Intronic
1117865868 14:60148675-60148697 CTGGGGAGAAGTGGGAGGGAAGG + Intronic
1117912245 14:60647535-60647557 GTGAGGATAAGGGGAAAGAAAGG - Intronic
1118086477 14:62423680-62423702 CAGGGGATGGGGGGCAAGGAGGG + Intergenic
1118352715 14:64985010-64985032 CTGGAAATAAGGGGACAGTATGG - Intronic
1118427989 14:65688254-65688276 CAGGGGTTAAGGGGCAAGGCAGG - Intronic
1118726772 14:68634490-68634512 CTGGGGCTAAGGGGAGTGGGAGG - Intronic
1118789022 14:69071958-69071980 CTGCTTATATGGGGAAAGGATGG - Intronic
1120711267 14:87795775-87795797 CTTGGGGTGGGGGGAAAGGAAGG - Intergenic
1120806434 14:88756054-88756076 CAGGGGACAAGGGGAAGAGAGGG + Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121405688 14:93717965-93717987 CTGGGGAAAATGGGACAAGAAGG - Intergenic
1122749099 14:103919752-103919774 CTGAAGTCAAGGGGAAAGGAAGG - Intronic
1123067693 14:105626758-105626780 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123071712 14:105645483-105645505 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123091376 14:105743759-105743781 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123097147 14:105772100-105772122 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123688012 15:22813381-22813403 GTGGGGCAAAGGGGAAAGGGGGG + Intronic
1123804104 15:23853853-23853875 CTGGTGATAAGGAGAAGGAAGGG + Intergenic
1124011034 15:25838768-25838790 CTGAGAAAATGGGGAAAGGACGG + Intronic
1124139597 15:27065530-27065552 CAGGGGATATTGGGAATGGAAGG - Intronic
1124174901 15:27415520-27415542 CTGGGGACCGGGGGAAAGGGTGG + Intronic
1124191290 15:27579348-27579370 CTAGGGATAAGGTAAATGGAAGG + Intergenic
1124475521 15:30030281-30030303 CTGGGGAGAAGGGAAAATGAGGG - Intergenic
1124837769 15:33212223-33212245 ATGAGGATGAAGGGAAAGGAAGG - Intergenic
1124849700 15:33324321-33324343 CTGGGGAAATGGGGGAAGGAAGG + Intronic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1126110896 15:45174122-45174144 GTGGGGAAAAGGAGAAAGGGAGG - Intronic
1126513712 15:49510167-49510189 GTGGTGATAATGGGATAGGATGG - Intronic
1127291720 15:57577435-57577457 CTGGAGATAAGAGGATAGGAGGG - Intergenic
1128212602 15:65913083-65913105 CCAGGGTTCAGGGGAAAGGAAGG + Intronic
1128258414 15:66214877-66214899 ATGGGGGTAAGAGGAGAGGAGGG + Intronic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1128638394 15:69317775-69317797 ATGGGGAGAAGGGGAAAGGAGGG - Intronic
1128669440 15:69563441-69563463 TTTGGCATAAGGGGAGAGGAGGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128909811 15:71503418-71503440 CTGGGGACAATGGGAAAGTGTGG - Intronic
1128957220 15:71960938-71960960 CTGGGGACAAGGAGAAAGTGTGG + Intronic
1129477871 15:75798453-75798475 CTGTGAAGAAGGTGAAAGGAAGG + Intergenic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1130037144 15:80371218-80371240 ATGGGGATGAGGGGAAAGAATGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130322779 15:82854536-82854558 ATGGGGATAAGGGCAAAGTTGGG + Intronic
1130405594 15:83598063-83598085 CTGTGGTTAAGGGGAAATAAGGG + Intronic
1130459845 15:84152748-84152770 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic
1130565611 15:84992350-84992372 CTCTGGATAAGGGGAAGGAAGGG + Intronic
1131097771 15:89666825-89666847 CAGAGGAGTAGGGGAAAGGAGGG + Intronic
1131307202 15:91255456-91255478 CTGGGGACTCGGGGAAAGGGTGG + Intronic
1131785207 15:95905035-95905057 CTGGGGGTAGGAGGAAAGGATGG - Intergenic
1132240084 15:100251154-100251176 CTGGGGATCAGGAGATAGGCTGG + Intronic
1132645316 16:996827-996849 CGGGGGCAAAGGGGAAAGGAAGG + Intergenic
1132727702 16:1345906-1345928 CTGGGGGTGAGGGGAACGGGTGG + Intronic
1133376785 16:5293745-5293767 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135183172 16:20292381-20292403 CTGGGGAGCAGGGGAGAGAATGG - Intergenic
1135291693 16:21244902-21244924 TTGGGGGTAAGGGGAAAGAGTGG - Intronic
1137274235 16:46923087-46923109 CTGGGGCTAAGGGGAGGGCAGGG - Intronic
1137363336 16:47840158-47840180 CTGGGGAGGAGGGGAGAGGTCGG - Intergenic
1137401331 16:48156380-48156402 TTTGGGATCAGGGGAAGGGAAGG + Intergenic
1137695103 16:50456302-50456324 TTGGTGAGATGGGGAAAGGAAGG + Intergenic
1137715887 16:50598097-50598119 TTGGGGACAAGGGGACAGAAGGG + Intronic
1138021445 16:53485749-53485771 CGGAGGATAAGGTGGAAGGATGG + Intronic
1138063976 16:53921240-53921262 CTGGGGGAGAGGGGAAGGGAGGG - Intronic
1138356197 16:56382911-56382933 CTGGGCACATGGGAAAAGGAAGG + Intronic
1138532055 16:57639828-57639850 CTGGGGAGAAGGGGAATGCACGG - Intronic
1138748016 16:59386036-59386058 GTGTGGCTAAGAGGAAAGGAAGG - Intergenic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1139955618 16:70691661-70691683 CTGGGGAAATGGGGCAGGGAAGG + Intronic
1140489377 16:75321609-75321631 CTAGTGATAAGCGGAAAAGAGGG + Intronic
1140494029 16:75367453-75367475 CTAGGGATAAGGGGGCAGGGTGG + Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141909738 16:87050490-87050512 CTGGGGAGAACGAGAAAGGAAGG - Intergenic
1142403334 16:89872665-89872687 TTGGGGACATGGGGACAGGAGGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143536526 17:7543699-7543721 GTGGGGAGAAGAGGACAGGAGGG + Intergenic
1144083175 17:11783193-11783215 CTAGTGATAAGTGGAAAAGAGGG + Intronic
1144191858 17:12853844-12853866 CTAGGAAGAAGGGAAAAGGAAGG - Intronic
1144202776 17:12956228-12956250 ATTGGGATGAGGGGAAAGGAGGG + Intronic
1144819036 17:18058593-18058615 CTGAGGAAAAGGCCAAAGGATGG - Intronic
1145193874 17:20869665-20869687 CCAGGGATAAGGGGAAAAGAGGG + Intronic
1145298161 17:21611506-21611528 CCAGGGATAAGGGGAAAAGAGGG - Intergenic
1145352096 17:22091891-22091913 CCAGGGGTAAGGGGAAAAGAGGG + Intergenic
1145722602 17:27088075-27088097 CCAGGGATAAGGGGAAAAGATGG - Intergenic
1145904430 17:28508432-28508454 TGGGGGATGGGGGGAAAGGAAGG - Intronic
1146123890 17:30217305-30217327 CTGGGGTGAAGGAGAAAGAAAGG + Intronic
1146845714 17:36180836-36180858 CCTGGGAGAAGGGGAAGGGATGG + Intronic
1146873932 17:36392713-36392735 CCTGGGAGAAGGGGAAGGGATGG + Intronic
1146881284 17:36443625-36443647 CCTGGGAGAAGGGGAAGGGATGG + Intergenic
1147065458 17:37920160-37920182 CCTGGGAGAAGGGGAAGGGATGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147743462 17:42681588-42681610 CTAGGGCTGAGGGGAAAGGCGGG - Intronic
1147818588 17:43228319-43228341 CTGGGGGTAGGAGGAAAGCAAGG - Intergenic
1147819285 17:43232088-43232110 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147819874 17:43235119-43235141 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147821186 17:43242517-43242539 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147825594 17:43267965-43267987 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147826725 17:43274432-43274454 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147827614 17:43279310-43279332 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147828721 17:43285471-43285493 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147830909 17:43297744-43297766 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147831608 17:43301373-43301395 CGGGGGAAAAGGGGGAAGGTCGG + Intergenic
1147831871 17:43303021-43303043 CTGGGGGTAGGAGGAAAGCAAGG - Intergenic
1147885907 17:43684320-43684342 CTGGGGATCTGGGGAAGGGAAGG + Intergenic
1147935599 17:44008856-44008878 CTGGGGATTAGGGGAGGGGAGGG + Exonic
1148028414 17:44604120-44604142 CTGGAGAAGAGAGGAAAGGAGGG + Intergenic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148478873 17:47946880-47946902 CTGAAGATAAGGGGTAGGGAGGG - Exonic
1148528489 17:48365918-48365940 CTAGTGATAAGTGGAAAAGAGGG - Intronic
1148583766 17:48762193-48762215 GGAGGGATAATGGGAAAGGAGGG - Intergenic
1148862858 17:50613551-50613573 CTGGGGTGACGGGGAGAGGAGGG + Intronic
1149347838 17:55756168-55756190 CTGGGGATAAGTGGTGAAGAAGG + Intronic
1149569417 17:57661884-57661906 CTGAGGACATGGGCAAAGGAGGG - Intronic
1149821532 17:59783671-59783693 CTGGGGATGGGAGGAAAGGAGGG - Intronic
1150925643 17:69528997-69529019 CTTGGGAAAAGGGGATAGGTGGG - Intronic
1150936764 17:69644074-69644096 CTGGTGATAAATGGAAAAGAGGG - Intergenic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1152117735 17:78398991-78399013 CTGGGGGTGAGGGGCAAGGTGGG + Intronic
1152621215 17:81365771-81365793 CTGGAGCTCAGGGGAAAGGCTGG + Intergenic
1152636607 17:81432854-81432876 CTGGGGATGGGGGGAAGGGTGGG - Intronic
1152636634 17:81432903-81432925 CTGGGGATGGGGGGAAGGGTGGG - Intronic
1152732486 17:81979161-81979183 CTGGGGGTGAGATGAAAGGATGG - Intronic
1153719281 18:7885110-7885132 CTGGGGTTCAGGGCCAAGGATGG - Intronic
1153953485 18:10076419-10076441 CAGGGGATTAGGGGACAGGGAGG - Intergenic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1154498504 18:14980441-14980463 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
1155190583 18:23425985-23426007 TTGGGCATAAGGCAAAAGGAAGG + Intronic
1155628946 18:27868626-27868648 TTGGGGATTCGGGGAAAGGGTGG + Intergenic
1155844324 18:30686537-30686559 CTGAGGAGCAGGGGTAAGGATGG - Intergenic
1156456209 18:37296048-37296070 TGGGGGACAAGGAGAAAGGAAGG - Intronic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157479187 18:48042203-48042225 CTAGTGATAAGTGGAAAAGAGGG - Intronic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1158605799 18:58895046-58895068 ACAGGGATAAGGGGAAAAGAAGG - Intronic
1159015258 18:63097246-63097268 CTGGGGAGGAGTGGAAAGGAAGG - Intergenic
1159257298 18:65963513-65963535 CTGGTGATAAGGCAAAAGGCAGG + Intergenic
1159942856 18:74421822-74421844 CTGGGAGAAAAGGGAAAGGAGGG + Intergenic
1160195096 18:76747196-76747218 CTGGGGACTTGGGGAAAGGCTGG + Intergenic
1160829094 19:1094639-1094661 CTGAGGACAAGGGCAAAGGGTGG + Intronic
1161271020 19:3389341-3389363 CTGGGGTTGAGGGGAGTGGAGGG + Intronic
1161580579 19:5078508-5078530 CGGGGGAGAAGAGGAAAGGCCGG - Intronic
1162293510 19:9796697-9796719 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
1162638785 19:11990775-11990797 CTGGGGAGGATGGGAAAGGGTGG + Intergenic
1162964325 19:14148893-14148915 CTGGGGGGAAGGGGACAGGTAGG - Exonic
1163083234 19:14958672-14958694 CAGGGGATGAGGTGGAAGGATGG - Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163682295 19:18690080-18690102 TTGGGGGTGAGGGGAAGGGAAGG + Intronic
1163697623 19:18771974-18771996 ATGGGGTGAAGGGGAAAGCAGGG - Intronic
1163826707 19:19528212-19528234 CTGGGGACTGGGGGAAAGAAGGG + Intronic
1164591867 19:29511875-29511897 GCGGGGATGAGGAGAAAGGAGGG + Intergenic
1164591965 19:29512274-29512296 ATGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1164592291 19:29513484-29513506 GGGGGTATAAGGAGAAAGGAGGG + Intergenic
1164592529 19:29514288-29514310 GGGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592539 19:29514308-29514330 GGGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592557 19:29514348-29514370 GGGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592581 19:29514410-29514432 TGGGGGATGAGGGGGAAGGAGGG + Intergenic
1165210415 19:34231325-34231347 ATGGGACTAAGTGGAAAGGAGGG + Intergenic
1165802509 19:38561736-38561758 GTGGGTGTAAGGGGAAAGCATGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1165922174 19:39306174-39306196 GAGGGGAGATGGGGAAAGGAAGG - Intergenic
1165981722 19:39729980-39730002 GTGGAGATAAGTGAAAAGGAAGG - Intergenic
1166404332 19:42508815-42508837 GTTGGGAAAAGGGGAAGGGAGGG + Exonic
1166645689 19:44530034-44530056 CTTGGGAGAAGGGGCAGGGAGGG + Intergenic
1166798790 19:45443693-45443715 CCGGGGACAATGGGCAAGGAGGG + Intronic
1167247523 19:48382792-48382814 TTGGGGATAGGGAGAAAGGGAGG - Exonic
1167257773 19:48441746-48441768 CTGGGGGGAGGGGGAATGGAGGG - Intronic
1167634512 19:50646714-50646736 TTGGGGACATGGGGAAAGGTTGG + Intronic
1167741108 19:51325519-51325541 CTAGGGATATGGGGAATGGAGGG - Intronic
1167811278 19:51833346-51833368 CTAGGGAAAATGGGAAAGAATGG - Intergenic
1167843109 19:52138636-52138658 CTGGGGACAATGGGAAAGTTTGG - Intronic
1168061489 19:53895106-53895128 CTGGGGATATAGAGAAAGCAGGG + Intronic
1168399755 19:56078561-56078583 CTAGTGATAAGTGGAAAAGAGGG - Intergenic
924976233 2:178136-178158 CTGGGGTTCAGAGTAAAGGAGGG + Intergenic
925590390 2:5503415-5503437 CAGGGAAGAAGGGGAAAGGGAGG - Intergenic
926094991 2:10075399-10075421 CAGGGGACAAGAAGAAAGGATGG - Intronic
926122917 2:10254533-10254555 CTAGGGATGGGGGGAAAGGCAGG + Intergenic
926320111 2:11743615-11743637 CTGGGGCTCCGGGGAAGGGAGGG - Intronic
926419484 2:12682524-12682546 GTGGGGAAGAGGGGAAGGGAGGG + Intergenic
926881060 2:17543583-17543605 CTGCGGAGAAGGGAAAGGGAAGG + Intronic
926934596 2:18074267-18074289 CTGAGGATGAGGGGACAGGGAGG - Intronic
927047980 2:19299006-19299028 CTGAGGATAATTGGAAAGAATGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927518810 2:23687281-23687303 CTGGGGATGCGGGGACAGCAGGG - Intronic
927525202 2:23733706-23733728 TTGGGGATGAGGGTAAAGAAGGG - Intergenic
928081346 2:28315105-28315127 GAGGGGAAAAGGGGAAGGGAAGG + Intronic
928681476 2:33707361-33707383 CTGGGTATGAGGGCTAAGGAAGG + Intergenic
929190997 2:39139577-39139599 GGGGGGATAAAGAGAAAGGAAGG - Intergenic
929246973 2:39712720-39712742 CAGGGGAGAAGTGGAAAGGAAGG + Intronic
929691854 2:44081554-44081576 ATGAGGAGAAGGGGAAAGAAAGG - Intergenic
929766782 2:44850301-44850323 CTGAGGCTAAGAGGAAAAGATGG - Intergenic
930027091 2:47035626-47035648 CTGGGGAAGAGAGGAAAGAAAGG + Intronic
930867303 2:56134592-56134614 CCTGTAATAAGGGGAAAGGAAGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931225173 2:60323202-60323224 CTGAAGACAAGGGGAAAGCATGG - Intergenic
931577487 2:63733903-63733925 CTGGGAAGAGGGGGAAATGAGGG - Intronic
932137740 2:69245403-69245425 CTGGGGAGGAGGGGGAAGGGTGG - Exonic
932369785 2:71177503-71177525 CTGGGGAGAAGGAGAAATGCAGG - Intergenic
932396967 2:71455006-71455028 CTGGGGAGAAGGGGAGTGGCAGG - Intronic
932519076 2:72389902-72389924 CTCGGAAAAAGAGGAAAGGAAGG - Intronic
932663013 2:73673272-73673294 CTGGAGACAAGGGCACAGGAGGG + Intergenic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
933746880 2:85578045-85578067 GTGGGGATAAAGTGAAAGGCCGG - Intronic
933939683 2:87234932-87234954 CTGAGGCTAAGGGCACAGGAAGG + Intergenic
934100651 2:88650141-88650163 CCAGGGATTAGGGGAAAGGGAGG - Intergenic
934987293 2:98896814-98896836 CTAGCGATAAGTGGAAAAGAGGG + Intronic
935042689 2:99448542-99448564 CTAGGAGTAGGGGGAAAGGAGGG - Intronic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935518537 2:104076476-104076498 CTGGGGTTAGGTGGAATGGAGGG - Intergenic
935573563 2:104687287-104687309 CTGGGGATCAGGGGGCAGAACGG - Intergenic
935642548 2:105304923-105304945 CTGGGGCTTAGGGGAAGGGAGGG + Intronic
935715246 2:105933647-105933669 CAGGAGTTAAGGGGAAAGTAGGG + Intergenic
935822086 2:106904249-106904271 CTGGTGGTAAGGGCAAAGAATGG + Intergenic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936353454 2:111730841-111730863 CTGAGGCTAAGGGCACAGGAAGG - Intergenic
936516613 2:113185273-113185295 GCAGGGAGAAGGGGAAAGGAGGG - Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
936837950 2:116730913-116730935 CTGGGGCTAAAGGGAAATGGGGG - Intergenic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937454788 2:122031876-122031898 CTGGGCAAAGGGGCAAAGGAAGG + Intergenic
937913723 2:127088772-127088794 CTGGGGGTGAGGGGAGAGGGCGG + Intronic
938468814 2:131542103-131542125 CCAGGGAGAAGGGGAAAAGACGG - Intergenic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
938818318 2:134927789-134927811 CTAGGGATTAGGGGAAATGATGG + Intronic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939955384 2:148523600-148523622 GTGGGGCTGAGGGGTAAGGAGGG + Intergenic
940154226 2:150636996-150637018 CTTGGGCTAAGGTGATAGGAAGG - Intergenic
940539337 2:154990367-154990389 GAGGGGATAAGGTGTAAGGAAGG - Intergenic
940559194 2:155272886-155272908 TCGGGGGTAAGGGGAAAGGAAGG - Intergenic
941085761 2:161115739-161115761 CTGGGGACAAGGGAAAAATATGG - Intergenic
941228914 2:162884415-162884437 GTGGGGATGAGAAGAAAGGATGG + Intergenic
941406675 2:165098582-165098604 CTAGTGATAAGTGGAAAAGAGGG - Intronic
941619301 2:167758426-167758448 CTGGGGATACAAAGAAAGGAAGG + Intergenic
942108223 2:172654846-172654868 CTAGGGATAAGCTGTAAGGACGG + Intergenic
942189077 2:173453369-173453391 CCAGGGATAAGTGGAAAGAATGG + Intergenic
944276977 2:197850277-197850299 CTTGGGACAAGGGGAAATGGTGG - Intronic
944629137 2:201605503-201605525 TGGGAGGTAAGGGGAAAGGAGGG - Intronic
944689849 2:202149137-202149159 CTGGGGGTAGGGGAGAAGGAGGG - Intronic
944834983 2:203570410-203570432 ATGGGGAAAGGAGGAAAGGAAGG - Intergenic
945701538 2:213176836-213176858 CTGGGGATAGGAGGAAAGGCTGG + Intergenic
946077440 2:217086294-217086316 CTGGGGATAAGTGGTAAGGAGGG - Intergenic
946853193 2:223927918-223927940 GGGGGGAAAGGGGGAAAGGAGGG + Intronic
947228614 2:227863426-227863448 CTGGGTAGAAGGGAGAAGGAGGG + Intergenic
947587090 2:231363024-231363046 CTGGGTATACGGGGAATGCAGGG + Intronic
947661207 2:231869980-231870002 GTGGGGAGGAGGGAAAAGGAAGG - Intergenic
947796516 2:232896896-232896918 GTGGGGGTAAGGGTAAAGGTAGG + Intronic
947983281 2:234427600-234427622 GTGGGGCGGAGGGGAAAGGAAGG - Intergenic
948091900 2:235302098-235302120 GTGGGGAGGAGGGGAATGGAAGG - Intergenic
948095024 2:235326631-235326653 TTGGGGATTTGGGGAAAGGGTGG + Intergenic
948146978 2:235715405-235715427 CTGGGGGTGAGGGGAAAGCAGGG + Intronic
948355347 2:237373117-237373139 ATGGGGAGAAGGGGGAAAGAGGG + Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
948915933 2:241035114-241035136 GTGGGAATAAGGGGAGAGTAGGG - Intronic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1170488985 20:16851917-16851939 CTGGGGACTCGGGGGAAGGATGG - Intergenic
1170767237 20:19300720-19300742 CTGGGGAGAAGAGACAAGGAGGG + Intronic
1171027438 20:21643776-21643798 GTGGGGCTGAGGGGAAAGAAAGG + Intergenic
1171562432 20:26137177-26137199 CCAGGGATAAGGGGAAAAGACGG + Intergenic
1171983725 20:31644966-31644988 CTGGGGTTAAGGGCAGGGGAGGG - Exonic
1172195840 20:33090808-33090830 CTGGGGTTCAGGGCAAAGGGTGG + Intronic
1172370997 20:34391106-34391128 CTGGCGCTCAGGGGAGAGGATGG + Intronic
1172463636 20:35138501-35138523 CTGGGGGGAAGGGGTAATGATGG + Intronic
1172745569 20:37205284-37205306 CTGAGCATAAGGGGGAAGGGAGG - Intronic
1172935355 20:38616187-38616209 CTTGGGGTGAAGGGAAAGGAGGG - Intronic
1172981125 20:38942630-38942652 CTGGGGAGTTGGGGGAAGGACGG + Intronic
1172994890 20:39063265-39063287 CTGGGGCTGAAGGGACAGGAGGG + Intergenic
1173173038 20:40742504-40742526 CTGGGCAACAGGGGAAGGGATGG + Intergenic
1174037566 20:47677744-47677766 CTGGGGGTCAGGGGACAGGGTGG - Intronic
1174171272 20:48619576-48619598 CTGGGTATCAGGGGAGGGGAGGG - Intergenic
1174265507 20:49328792-49328814 AGGGGGATCAGGGCAAAGGAAGG - Intergenic
1175144597 20:56886098-56886120 AGGGTGATAAGGGGGAAGGAGGG + Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175700431 20:61132922-61132944 CTGGGGCAAAGGGGAAAGGTCGG + Intergenic
1175714127 20:61244313-61244335 CTGGGGTTCTGGGAAAAGGATGG + Intergenic
1175891217 20:62316852-62316874 CTGGGGCTGAGGGGAAGTGAGGG + Intronic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1177259159 21:18706768-18706790 CTGAGGAGAGGGGAAAAGGAGGG - Intergenic
1177665226 21:24147946-24147968 AAGAGGATAAGGAGAAAGGAGGG - Intergenic
1177729692 21:25012376-25012398 CGGGGGATAGGGGGAAGGGAGGG - Intergenic
1177917502 21:27108181-27108203 CTGTTGATCATGGGAAAGGATGG + Intergenic
1177983446 21:27944208-27944230 TTGGGGACTAGGGGAAAGGGTGG - Intergenic
1178321612 21:31610327-31610349 CAGGGGAGAAGGGGGAAGGTAGG + Intergenic
1178393209 21:32216218-32216240 CTGGGGGTACGGGTAAGGGATGG - Intergenic
1178573644 21:33764512-33764534 CAGGGGATGGGGGCAAAGGAGGG + Intronic
1179061405 21:37982994-37983016 GTGGGGAGAGAGGGAAAGGAAGG - Intronic
1179308160 21:40173683-40173705 CTGGGGTGGAGGGGAGAGGATGG - Intronic
1180469235 22:15641037-15641059 CCAGGGAGAAGGGGAAAAGACGG - Intergenic
1180610928 22:17097513-17097535 TTGGGAATAAGGGCACAGGAGGG - Intronic
1181433196 22:22895214-22895236 CAGGGCATGAGTGGAAAGGATGG + Intronic
1181437383 22:22918641-22918663 CTGGGGACTTGGGGAAATGAAGG + Intergenic
1181489090 22:23250438-23250460 CTAGTGATAAGTGGAAAAGAGGG + Intronic
1181520752 22:23448269-23448291 CTGGGGATGCGGGGTGAGGAGGG - Intergenic
1181549873 22:23631737-23631759 CTGGGGATGAGGGTAAGGGAAGG + Intronic
1181760232 22:25053314-25053336 CTGGGGAAAAGAGGAGAGGGAGG - Intronic
1181798519 22:25327795-25327817 CTGGGGATGAGGGTAAGGGAAGG - Intergenic
1181943615 22:26498206-26498228 TTGGGGACTCGGGGAAAGGATGG + Intronic
1182430510 22:30296023-30296045 CAGGGGCAAAGGGGCAAGGAGGG + Intronic
1182620531 22:31616190-31616212 AAGGGGATGAGGGGACAGGAAGG + Intronic
1182812725 22:33131371-33131393 CTGGGAATAGGGATAAAGGAAGG - Intergenic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183254402 22:36753159-36753181 ATGGGGATGAGGGGTAAGGTAGG - Intergenic
1183634533 22:39052954-39052976 CTGGGGAGATGGGAAAAGGCAGG - Exonic
1184802415 22:46769630-46769652 CTGGGGAGGAGGGGCATGGAGGG + Intronic
1184905484 22:47482782-47482804 CTGGGGATGAGGGGAAGTTAGGG + Intronic
1185013183 22:48327886-48327908 CTGGGGAGAAGAGGAGAGGGTGG - Intergenic
1185083491 22:48723048-48723070 CTGGGGCTCAGGGGACAGGCTGG - Intronic
1185284438 22:49994063-49994085 CTGGAGATCAGGGGAATGGGGGG - Intergenic
1185354278 22:50357465-50357487 GGGAGGAAAAGGGGAAAGGAAGG - Intronic
1185380172 22:50504330-50504352 CTGGGGAGCAGGGGTAAGGCTGG - Exonic
949190742 3:1245522-1245544 TTGGGGATTGGGGGAAAGGGTGG + Intronic
949374295 3:3370047-3370069 TTGGGGACTCGGGGAAAGGATGG - Intergenic
949530632 3:4951763-4951785 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
950126207 3:10511260-10511282 ATGGGGAAAAGGGGGACGGAGGG - Intronic
950271654 3:11620761-11620783 CTGGGGGTGAGAGGGAAGGAGGG - Intronic
950308845 3:11938460-11938482 AAGGGGATGAGGGGAAAGAAAGG + Intergenic
950626440 3:14250879-14250901 CTAGTGATAAGCGGAAAAGAGGG + Intergenic
951510025 3:23489910-23489932 ATGGGGGGAAGGGGAAAGAAAGG - Intronic
951536433 3:23744678-23744700 CTGCGGATAAGGGGAACCCAAGG + Intergenic
951536466 3:23744850-23744872 CTGGGGCTTAGGGTAAAGGCAGG + Intergenic
951675997 3:25242476-25242498 CTTTGTATAAGGTGAAAGGAAGG + Intronic
951698785 3:25473371-25473393 CTGGGGTGAAGGGGAAAAGCTGG + Intronic
953020926 3:39112563-39112585 CTGGGGCTGATGGGAAAGGTGGG + Exonic
953125757 3:40090378-40090400 TTGGGGAAAAGAGGAAAGGAAGG + Intronic
953864838 3:46575389-46575411 GTGGGGAGAAGGGGAAGGGAAGG - Intronic
954716960 3:52531730-52531752 CTAGGGCTGAGGAGAAAGGAGGG - Intronic
956514905 3:70035722-70035744 CTGATGATAGCGGGAAAGGAAGG + Intergenic
956879470 3:73495945-73495967 ATGGGGATAGGGGGAAGGGTAGG - Intronic
956990696 3:74759869-74759891 CTGGGGACTCGGGGAAAGGGTGG + Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957225163 3:77433851-77433873 CAGGGGATAAGGGAAAGGGAAGG - Intronic
957499506 3:81035413-81035435 CAGGGGTGAAGGGGAAGGGATGG - Intergenic
957566332 3:81888834-81888856 CTGGTGATTTGGGGAAGGGAGGG + Intergenic
957673938 3:83342078-83342100 ATTTGGATAAGGGGTAAGGAAGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957944376 3:87043921-87043943 CTAGTGATAAGTGGAAAAGAGGG + Intergenic
959829094 3:110838852-110838874 ATGGGGAAAAGGTGAAAGAATGG + Intergenic
960302335 3:116018784-116018806 GTGGTGAGAAGGGGAAAGAAAGG + Intronic
960545423 3:118908779-118908801 CTGGAACTAAGGAGAAAGGATGG - Intronic
960551794 3:118984223-118984245 CTGGTTATAAGGGGAGGGGAAGG - Intronic
961007597 3:123415257-123415279 CTGGGGACCAGGGGACAGGGTGG + Intronic
961025912 3:123557303-123557325 CTGGGGATAAGGGGAGGGGGTGG - Intronic
961287823 3:125820650-125820672 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
961623894 3:128245847-128245869 CTGGGGATAGAGGGAAGGCATGG - Intronic
961899247 3:130195343-130195365 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
962153105 3:132914130-132914152 CTTGGTATAAGGTGTAAGGAAGG + Intergenic
962234091 3:133693150-133693172 CTAGGGATAAGGAGGAAGGTGGG - Intergenic
962710482 3:138081654-138081676 CTGGGGGAGAGGGAAAAGGAGGG + Intronic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
963017332 3:140838385-140838407 CTGGGGATGAGGGGCTTGGAGGG + Intergenic
963779594 3:149474018-149474040 CTAAGGCTAAGGGGAAAGGAAGG - Exonic
963936715 3:151061216-151061238 ATGGGCATAAGTGGAATGGAGGG - Intergenic
964341072 3:155708938-155708960 CAGGGGCTAAGGGGGAGGGAGGG - Intronic
964646843 3:158967719-158967741 CAAGGGATAATGTGAAAGGAAGG + Intronic
965080389 3:164024793-164024815 TTGGAGAAAGGGGGAAAGGAGGG + Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965520201 3:169662946-169662968 CTGGGGGGAAGGGGAGGGGAGGG + Intronic
965528562 3:169747421-169747443 ATGGGGATAGGGGTAAAAGAAGG + Intergenic
966108351 3:176363542-176363564 TTGGGGATTCGGGGAAAGGGTGG + Intergenic
966638972 3:182168265-182168287 CATGGGAAAAGGGGGAAGGAGGG - Intergenic
968074308 3:195808174-195808196 CTGGGAAGACGGGGGAAGGAGGG - Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969995036 4:11303213-11303235 CTGAGAATAAAGGGAAGGGATGG - Intergenic
970313694 4:14809180-14809202 AAGGAGAGAAGGGGAAAGGAGGG + Intergenic
970325577 4:14920175-14920197 CTGAGGATCAGGGAAAGGGATGG + Intergenic
971723161 4:30273266-30273288 TTTTGGATAAGGTGAAAGGAAGG + Intergenic
972196979 4:36665481-36665503 GAGAGGAAAAGGGGAAAGGAGGG - Intergenic
973291511 4:48475815-48475837 TTGGAGATAACAGGAAAGGAGGG + Intergenic
973633819 4:52843663-52843685 CTGGAGAAATGAGGAAAGGAGGG - Intergenic
973792107 4:54387494-54387516 TTGGGGATTTGGGGAAAGGGTGG - Intergenic
973976324 4:56266437-56266459 GTGGGAAGAAGGGGACAGGAGGG - Intronic
974858865 4:67495515-67495537 CTGGCGACAAGTGGAAAAGAGGG + Intronic
975043903 4:69778895-69778917 CAAGGGCTAAGGGGAAGGGAGGG + Intronic
976022803 4:80650848-80650870 TTGGGACTCAGGGGAAAGGATGG + Intronic
976261546 4:83150067-83150089 CAGGGGAGAAGAGGAAAGAAAGG - Intergenic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977120526 4:93093830-93093852 CCAGGGAAAAGGGGAAAGGAGGG + Intronic
977153453 4:93543260-93543282 TTTGGTATAAGGGGAAAGAAAGG + Intronic
977292918 4:95182466-95182488 CAGGTGATTAGGGGAAAGGGAGG + Intronic
977313373 4:95414192-95414214 GTGGGGAAAAGGGGAAGGAAAGG - Intronic
977578634 4:98701078-98701100 CTGGGGAAAAAGTGAAAGAAAGG - Intergenic
977854390 4:101872037-101872059 CTGGAAATGAGGGGAAAGAAAGG + Intronic
979830352 4:125293014-125293036 CAGGGGTTAAGGGGAAGGGGAGG + Intergenic
979987365 4:127331555-127331577 CTTGGGAAAAGGGAAATGGAAGG + Intergenic
981041858 4:140230512-140230534 TTGGGGAAGAAGGGAAAGGATGG - Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
982303334 4:153902520-153902542 CTGGGGAACAGTGGAAAGGTAGG - Intergenic
982389676 4:154850834-154850856 CTGAGGTAGAGGGGAAAGGATGG + Intergenic
983096446 4:163567935-163567957 CTTGAGATAATGGGAAAGAAGGG - Intronic
983845892 4:172517022-172517044 CTGGGGGGAAGAGGAAATGAAGG + Intronic
984541185 4:181039611-181039633 GGAGGGATAAGGGGAAAAGAGGG - Intergenic
984823093 4:183901060-183901082 CTGGAGGAAAGGTGAAAGGAGGG - Intronic
985103499 4:186480391-186480413 AAGGGGATTAGGAGAAAGGAGGG - Intronic
985225217 4:187752816-187752838 TTAGGGCTTAGGGGAAAGGAGGG - Intergenic
986026247 5:3854215-3854237 CTCGGCATAGGGGGAAAGAAAGG + Intergenic
986331047 5:6716253-6716275 CTGGGGATCTGGGGCAGGGACGG + Intronic
986620446 5:9667509-9667531 GTGGGGATAAGGGGAACATACGG - Intronic
986621383 5:9679192-9679214 CAGGGGACAGGGGGAAAGGAAGG + Intronic
987029878 5:13965988-13966010 TTAGGGATTGGGGGAAAGGATGG - Intergenic
987123788 5:14792406-14792428 CTGGTGATGATGGGACAGGAGGG + Intronic
987602911 5:20095153-20095175 CGGGGGATGAGGGGCAAGGGAGG + Intronic
988472858 5:31556956-31556978 ATGAGAATAAAGGGAAAGGATGG - Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
988846605 5:35134020-35134042 CTGGGGACTTGGGGAAAGGTTGG + Intronic
988994202 5:36698682-36698704 ATAGGGATAAAGGGTAAGGAGGG + Intergenic
989137364 5:38168283-38168305 CAGGGGGGAAGGGGAAAAGAAGG - Intergenic
989814624 5:45721262-45721284 CTGGAGATGAGGTGAAAGAAAGG - Intergenic
990382115 5:55228253-55228275 CTAGGTATAAGGGGAAAACAAGG - Intergenic
990805458 5:59655669-59655691 CTGTTGATAAGTGGAAAAGAGGG + Intronic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992199572 5:74370164-74370186 CTGGGGATAAAGGGACAAGATGG + Intergenic
994134073 5:96264637-96264659 CATGGGAGAAGGGGAAAGTATGG + Intergenic
994241105 5:97422547-97422569 GTGGGGCTTAGGGAAAAGGAAGG - Intergenic
994307626 5:98226105-98226127 CTGAGGATGAGGGGAGAGTAGGG + Intergenic
995576196 5:113537575-113537597 ATGGGAATAGTGGGAAAGGAAGG - Intronic
995732566 5:115262099-115262121 CTGGGGATGAGAAGAAAGAAAGG - Intronic
995862531 5:116656797-116656819 ATGAGGATGAGGGGAAAGAAGGG + Intergenic
996640240 5:125743150-125743172 CTGGGGACTTGGGGGAAGGATGG + Intergenic
996792981 5:127313157-127313179 CTGGGGCTCTTGGGAAAGGATGG + Intronic
996841782 5:127854281-127854303 CTGCAGATAAGGGTAAATGAAGG - Intergenic
997039752 5:130238044-130238066 CTTGGGTGAAGGGGAAGGGAGGG - Intergenic
997377551 5:133408233-133408255 TTGGGAATAAGGGAAAAAGAGGG - Intronic
997678995 5:135736069-135736091 CTGGGGAGGAGGGGAGAGGTCGG + Intergenic
998045664 5:138984727-138984749 CTGGGTATAAGGGGATGGTAGGG - Intronic
998175943 5:139902188-139902210 CTGGGGAGAAGGGGAAATGGGGG + Intronic
998450079 5:142227486-142227508 CTGGGGGTGAGGGTAGAGGAAGG - Intergenic
999554213 5:152722762-152722784 CTGGGGAGAAGAGGAAAAGGAGG - Intergenic
999708457 5:154295069-154295091 CTGGGAATCAGGGGAAGGGATGG - Intronic
999917148 5:156275141-156275163 CAGGGGATTATGGGCAAGGAAGG - Intronic
1000127055 5:158255790-158255812 GTGGAGAGAAGGGGAAAGGTTGG + Intergenic
1000140364 5:158397475-158397497 GTTGGGTTCAGGGGAAAGGAAGG - Intergenic
1000882192 5:166711198-166711220 CTGGGGAGCAGGGGAAAGCAGGG - Intergenic
1001264341 5:170261786-170261808 CTGGGGAGAAGGGGAAGAGCTGG + Intronic
1001712363 5:173789134-173789156 CTGGGGCCAAGGGGAAAGGTTGG - Intergenic
1002212038 5:177604891-177604913 CCGGGGATTAGGGAAAGGGAGGG + Intronic
1002990152 6:2230952-2230974 CTGGGTATTAGGGGAAGGAACGG - Intronic
1003106753 6:3222577-3222599 CTGGTGAGAAGGGGACAGGCAGG - Intergenic
1003131912 6:3402084-3402106 ATGGGGAGAAGGGTGAAGGAGGG - Intronic
1004404632 6:15321239-15321261 GTGGGGATAAAGGGAATGAAGGG + Intronic
1004407437 6:15347218-15347240 ATGAGGATATGGGGAAAAGAAGG + Intronic
1005165739 6:22918273-22918295 CTGGAGCTCAGGGGTAAGGAAGG - Intergenic
1005765850 6:29011581-29011603 CTGGGGAGAAAGGGGACGGAGGG + Intergenic
1005877911 6:30028119-30028141 CTGGGGACTCGGGGAAAGGGAGG + Intergenic
1005959729 6:30686593-30686615 CCAGGGAAGAGGGGAAAGGAGGG + Exonic
1006319639 6:33312974-33312996 CAGGGGGTAGGGGGAAAGCAGGG - Intronic
1006455885 6:34131638-34131660 GTGGAGATGAAGGGAAAGGATGG - Intronic
1006580358 6:35073520-35073542 CTGAGGAAGAGGGGACAGGAGGG - Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1007036405 6:38678467-38678489 CTGGGGAGAATGGGTGAGGATGG + Intronic
1007275840 6:40673046-40673068 ATGGAGAGAAGGAGAAAGGAAGG - Intergenic
1007358764 6:41340989-41341011 GTGGGGAGAAGGGGAAAGAAGGG - Intronic
1007540335 6:42636771-42636793 ATGGGGAATGGGGGAAAGGAGGG + Intronic
1007576859 6:42930648-42930670 CTGGGGTTACGGGGCTAGGAAGG - Intronic
1007622885 6:43225661-43225683 CTGGGGCTAAGAGGAAGGAATGG + Exonic
1007781753 6:44258366-44258388 CTGGGGATAAGGGTAACCCAGGG - Exonic
1008063879 6:47026891-47026913 GTGGGGAACAGGGAAAAGGATGG + Intronic
1008362340 6:50635552-50635574 GAGGGGAGAAGGGGAAAGGGAGG + Intergenic
1010001478 6:70954665-70954687 CTTGGGAGAAGGGGAATTGAGGG + Intronic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1011346557 6:86375909-86375931 CTGGGGAAAAGGTGAAGGAAGGG - Intergenic
1011781285 6:90792304-90792326 CTGAGGATAATGGGAAAAAATGG + Intergenic
1012776505 6:103500842-103500864 GTGGGGATGAGGGGAGAGGATGG - Intergenic
1013869592 6:114741164-114741186 CTGGGGAAAAGTGGATATGAAGG + Intergenic
1014233023 6:118925100-118925122 AGGGGGAAAAGGGGAGAGGAGGG + Intronic
1014580454 6:123130214-123130236 CTGTGTTTTAGGGGAAAGGATGG + Intergenic
1014992259 6:128095482-128095504 CTAGTGATAAGTGGAAAAGAGGG + Intronic
1015564923 6:134559574-134559596 TTGGGGACTCGGGGAAAGGATGG - Intergenic
1015709739 6:136126788-136126810 CTGGGGACTCGGGGAAAGGATGG + Intronic
1015891742 6:137976698-137976720 CTGGGATGAAGGGGACAGGAAGG - Intergenic
1016361306 6:143270204-143270226 GTGGGAAGAGGGGGAAAGGATGG - Intronic
1017915961 6:158831872-158831894 CTTGGGATAAAGGGAAGAGAAGG - Intergenic
1019587010 7:1810590-1810612 CAGGAGATGAGGGGAAGGGAGGG + Intergenic
1019590487 7:1827978-1828000 CTGGGGATGCGGGGTGAGGAGGG + Intronic
1019890653 7:3943369-3943391 GGGGGGAGAAGGGGAAAGAAGGG - Intronic
1019982121 7:4629427-4629449 GGGGGGTTGAGGGGAAAGGAGGG - Intergenic
1020392240 7:7670729-7670751 CAGGGTGTAAGGGTAAAGGAGGG - Intronic
1020843707 7:13255845-13255867 CTGGGGTTAAGGAGTAAGGTGGG + Intergenic
1020938081 7:14493229-14493251 CTGTAGATAAGGGGAAAACATGG - Intronic
1021478963 7:21094534-21094556 CTGGGGAAATGGGGGAAGGGTGG - Intergenic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1021867665 7:24974827-24974849 GTGGGGATTAGGGGAATGGACGG + Intronic
1022144701 7:27525335-27525357 ATGGGAATAAAGAGAAAGGAGGG - Intergenic
1023577817 7:41648261-41648283 TTAGGGATAAGGGAAATGGAAGG - Intergenic
1023669832 7:42563959-42563981 TTGGGACTCAGGGGAAAGGATGG + Intergenic
1024330542 7:48150417-48150439 CTGGGGATAAGGGAGAGAGAGGG + Intergenic
1024806513 7:53147825-53147847 CTAGCGATAAGTGGAAAAGAGGG - Intergenic
1026403862 7:70044082-70044104 ATGGGCATGAGAGGAAAGGAGGG - Intronic
1026499883 7:70935368-70935390 CCAGGGATCAGGGGAAAAGAGGG - Intergenic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1027697541 7:81430844-81430866 CAGGGGATGATGGGAAAAGAAGG - Intergenic
1027708489 7:81566985-81567007 CTGGGGTTATGGGTACAGGATGG - Intergenic
1027807229 7:82843389-82843411 CAGGGGCTAAGAGAAAAGGAAGG + Intronic
1028093000 7:86726363-86726385 CTCTGGATAAGGGGAAATGATGG + Intronic
1028285681 7:88995539-88995561 CTTGGGATTTAGGGAAAGGATGG - Intronic
1029069190 7:97881422-97881444 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1029493174 7:100883353-100883375 ATGAGGAAAAGGGGAAAGGGAGG - Intronic
1029631982 7:101758060-101758082 CTGTGGATAAGTGGAAACGTGGG - Intergenic
1030361285 7:108597856-108597878 CAGGGCCTAAGGGGAAAGGGAGG + Intergenic
1030971412 7:116062026-116062048 TTGGGGACTAGGGGAAGGGATGG - Intronic
1030973691 7:116093954-116093976 CTGGGGAAAATGGAAAATGAAGG - Intronic
1031037802 7:116807206-116807228 GGGGAGAAAAGGGGAAAGGAAGG + Intergenic
1031396499 7:121280484-121280506 CTGGGGATTAGAGGAAGGGTGGG + Intronic
1031623174 7:123960666-123960688 AGGGGGGTATGGGGAAAGGAAGG - Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032092898 7:128920533-128920555 CAGGGGATGAGGGGGCAGGAGGG + Intergenic
1032477773 7:132224116-132224138 CTGGGGTAAAGGGGAAAGGTGGG - Intronic
1032479491 7:132235133-132235155 CTGGGGAGGAGAGGAATGGAAGG + Intronic
1032626864 7:133600723-133600745 CTGGGAATAAAGGGCAAAGATGG - Intronic
1032718409 7:134530476-134530498 CTGGGGATAAGAGAATATGATGG + Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033160841 7:138995408-138995430 TGGTGGAGAAGGGGAAAGGATGG - Intergenic
1033199982 7:139360181-139360203 TGGGGGATAAGGGGAAGGGATGG - Exonic
1033765912 7:144490066-144490088 TTGGGGATCAGGGTAAAGGATGG + Intronic
1034233103 7:149548027-149548049 CTGAGGATAAGGGTTAATGAGGG - Intergenic
1034427222 7:151020358-151020380 CAGGGGAGGAGGGGAAAGAAGGG + Intronic
1035400723 7:158563751-158563773 TGAGGGATAAGGGGAAGGGAGGG - Intronic
1035545372 8:478187-478209 CTGGGCAGGAGGGGAGAGGAGGG - Intergenic
1035707442 8:1688130-1688152 CTGGGGGTGAGGGGAGTGGAGGG - Intronic
1035822264 8:2606091-2606113 TTGGGGAGAAAGGCAAAGGAAGG - Intergenic
1036251446 8:7166193-7166215 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1036300561 8:7566629-7566651 CTGGGGAAAAAAGGAAGGGAAGG - Intergenic
1036366042 8:8121267-8121289 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1036665380 8:10734034-10734056 CTGGGGGGAAGGGGAGAGGGAGG + Intronic
1036705936 8:11046988-11047010 CTGGGGAGAAGGGAAATGGGGGG + Intronic
1036884895 8:12544813-12544835 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1037569877 8:20149130-20149152 CTGGGGAGAGGAGGAAATGAAGG + Intronic
1037899716 8:22680658-22680680 TTGGGGGTAAGTGGGAAGGATGG - Intergenic
1037910452 8:22740894-22740916 CTGGGGAGAAGGGAAAGGGCTGG + Intronic
1038027334 8:23603417-23603439 CTGAGGAGATGGGCAAAGGAGGG - Intergenic
1038104458 8:24416751-24416773 CTGAGGTTAAGGAGAAGGGAGGG - Intergenic
1038255391 8:25946552-25946574 ATGGAGATAAGGTGCAAGGAGGG - Intronic
1038301757 8:26357113-26357135 CTGGGTAGATGGGAAAAGGATGG + Intronic
1038376263 8:27043046-27043068 CTGGGGATGAGGGGAAGGCAGGG - Intergenic
1038961679 8:32527010-32527032 CTGGGGCATAGGGGAAAGGTTGG - Intronic
1039011211 8:33095433-33095455 CTGGGGCCAAGGGTAAAGGGAGG + Intergenic
1039099016 8:33920899-33920921 ATGGGGAGAAGAGGAAAGGAGGG + Intergenic
1039589392 8:38734035-38734057 ATGGGGAACTGGGGAAAGGAAGG + Intronic
1039600528 8:38833233-38833255 CTAGTGATAAGCGGAAAAGAGGG + Intronic
1040515484 8:48130907-48130929 TTGGGGGTAAGGGGGAAGCAAGG - Intergenic
1040955587 8:52976690-52976712 GAGGGGGAAAGGGGAAAGGATGG - Intergenic
1040983509 8:53269231-53269253 CTGGGGAGAAGAGGAAAAGGAGG + Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042263442 8:66884240-66884262 TAGGGAATAGGGGGAAAGGAAGG - Intronic
1042285746 8:67108633-67108655 CTGCGGAGAAGGGGAAAGTGTGG - Intronic
1044477670 8:92647222-92647244 CTGGGGATAACGGACAAGCAAGG + Intergenic
1045188010 8:99857889-99857911 CTAGGGTTTAGGGCAAAGGAGGG - Intronic
1045251914 8:100489703-100489725 CAGGGGTTAAGAGGGAAGGAAGG + Intergenic
1045949019 8:107830535-107830557 ATTGGGAGAAGGGGAAAGGGAGG - Intergenic
1046029296 8:108764395-108764417 AGAGGGATAAAGGGAAAGGAAGG + Intronic
1046191191 8:110796180-110796202 CTGGGAGGAAGTGGAAAGGATGG - Intergenic
1046322943 8:112601735-112601757 TTGGGGAAAAAGGGAAAGGCAGG + Intronic
1046740184 8:117819594-117819616 CGGGGGATAACAGGTAAGGAGGG + Intronic
1047092373 8:121588329-121588351 ATGGGGAGAAAGGGAAAAGAAGG - Intergenic
1047684038 8:127285736-127285758 CTGGGTCAAAGGGGAAAGGATGG - Intergenic
1047786650 8:128159846-128159868 TTGGGGGTGAGGGGACAGGAAGG - Intergenic
1048579928 8:135722506-135722528 TTGGGGGTAAGGGCAAAGCAGGG + Intergenic
1048662738 8:136624055-136624077 CCAGGGATAGAGGGAAAGGAAGG - Intergenic
1049218032 8:141416728-141416750 CTGGGGAGCAGAGGACAGGAGGG - Intronic
1049465895 8:142751171-142751193 CTGGGGAGAAGGGACAAGGGCGG + Intronic
1049762984 8:144339177-144339199 CTGGGGGTGAGGGGGAAGGGGGG - Intergenic
1049938714 9:524245-524267 CTGGGGAAAAGGGAAAGGAAGGG - Intronic
1050134673 9:2449259-2449281 TTAGGGGTAAGGGTAAAGGAGGG + Intergenic
1050469500 9:5971844-5971866 TTGAGGATGAGGGGAAGGGAAGG - Intronic
1050588798 9:7141260-7141282 CTAGTGATAATGGGAAAAGAGGG - Intergenic
1050595798 9:7203580-7203602 ATGGGGTTAAGGGGGAGGGAGGG - Intergenic
1050848772 9:10258014-10258036 GTGGGGAGAAGGGGGCAGGAAGG + Intronic
1051008417 9:12379509-12379531 GTGGGTAGGAGGGGAAAGGAGGG - Intergenic
1051157903 9:14171254-14171276 CATGGAAGAAGGGGAAAGGAAGG - Intronic
1052035030 9:23670674-23670696 CTAGTGATAAGCGGAAAAGAGGG - Intergenic
1052316992 9:27125519-27125541 CTGGGCATAAGGTGAAAAGATGG - Intronic
1052578305 9:30319374-30319396 GTGGTGATAGGTGGAAAGGAGGG + Intergenic
1052739135 9:32376378-32376400 CTGGGGTACAGGGGAAAGGAAGG + Intergenic
1053135681 9:35649173-35649195 CTGGGGATGAGGGGCCAAGAGGG - Intergenic
1053135897 9:35650146-35650168 CTGGAGAAAAGGGGGAGGGAAGG - Intronic
1053137481 9:35660534-35660556 CTGGGGATAAGGGAAAAAAGGGG - Exonic
1053137842 9:35662786-35662808 ATGGGAATAAGAGGAAAGGGAGG + Intronic
1054936256 9:70691940-70691962 CTAGTGATAAGAGGAAAAGAGGG - Intronic
1056034062 9:82585115-82585137 CTTGGGGTAGGGGGAAAAGAAGG - Intergenic
1056174151 9:84017747-84017769 CCGGGCAAAAGGGAAAAGGAAGG - Intergenic
1056587949 9:87940419-87940441 CCAGGGATAAGAGGAAAAGACGG + Intergenic
1056608919 9:88112526-88112548 CCAGGGATAAGAGGAAAAGACGG - Intergenic
1056701761 9:88917130-88917152 CTAGTGATAAGTGGAAAAGAGGG - Intergenic
1057202563 9:93150473-93150495 CTGGGGGAACTGGGAAAGGACGG - Intergenic
1057209930 9:93195050-93195072 CCAGGGATTAGAGGAAAGGAGGG + Intronic
1057351724 9:94304342-94304364 CTGGGGATCAGGGAACAGGAGGG - Intergenic
1057389512 9:94630951-94630973 CTGGGGATTGGGGGAAGGGGAGG + Intronic
1057396917 9:94688845-94688867 CTGGGGAAGAGGGGCAAGGATGG + Intergenic
1057527382 9:95815058-95815080 GTGGGGAGCAGGGGAAAAGACGG + Intergenic
1057960875 9:99455599-99455621 CTGGTGTTTAGGGGAAAGCAAGG - Intergenic
1058077456 9:100665445-100665467 CTGGGGATGGGGGGGAAGGTGGG - Intergenic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058787970 9:108409337-108409359 GTGGGGATTAAGGGACAGGAGGG + Intergenic
1059354203 9:113686981-113687003 CGGAGGAGAAGGGGAAAGTAGGG + Intergenic
1059380010 9:113915712-113915734 CTGGGGGAAGGAGGAAAGGAGGG + Intronic
1059429886 9:114243581-114243603 CTGGGGACAAGAGGAAAGAGGGG + Intronic
1059486055 9:114627602-114627624 CTAGGGAGAAGGGAAAAGGGTGG + Intronic
1059704423 9:116807413-116807435 CCAGGGATTAGGGGAAAGCAAGG - Intronic
1060356087 9:122908612-122908634 GTGGGGGGAAGGGGGAAGGATGG - Exonic
1060433736 9:123574703-123574725 CTAGTGATAAGTGGAAAAGAGGG - Intronic
1060436954 9:123601899-123601921 GTGGTGAGGAGGGGAAAGGAGGG - Intronic
1060520748 9:124292647-124292669 CTGGGGCTTAAGGGAAGGGATGG - Intronic
1060872082 9:127050682-127050704 CTAGAGATAAGGGAAAAGAAGGG - Intronic
1061047613 9:128175508-128175530 GTGGGGCTGAGGGGACAGGAAGG - Intronic
1061842438 9:133367130-133367152 CTGGAGAAGAGGGGAATGGAGGG + Intronic
1061888585 9:133605883-133605905 CTGGGGAGGAAGGGAAATGATGG - Intergenic
1062372969 9:136249535-136249557 CTGGGGAGCTGGGAAAAGGACGG + Intergenic
1062430121 9:136523189-136523211 CTGGAGACAAGGGGACAAGAGGG + Intronic
1062588676 9:137263357-137263379 CGGGGGAGAAGGGAGAAGGAGGG - Intronic
1062633184 9:137476397-137476419 CTGGGATTGAGTGGAAAGGAGGG + Intronic
1185589024 X:1261588-1261610 ATGGGATTAAGGGGCAAGGAGGG - Intergenic
1185747670 X:2584856-2584878 GTGAGGAAAAGAGGAAAGGAAGG - Intergenic
1186050759 X:5592418-5592440 CCGTGGATAAGGGGGAACGACGG + Intergenic
1186061953 X:5718588-5718610 CTGGTGATAAGGGAAGATGATGG + Intergenic
1186521364 X:10209383-10209405 CTGGGAACAAGACGAAAGGAAGG - Intronic
1186782212 X:12924505-12924527 GTGGGGAAAAGGGGAAAAGGAGG - Intergenic
1186870337 X:13765245-13765267 TTGGACACAAGGGGAAAGGAAGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187266870 X:17741725-17741747 CTAGGGATAAGTGGAAAAGAGGG + Intronic
1187489860 X:19740893-19740915 CAGGGGAAGTGGGGAAAGGACGG + Intronic
1188393901 X:29656422-29656444 CTGGGGAGTTGGGGGAAGGATGG - Intronic
1188736037 X:33717506-33717528 CAGGGGATGTGGGGAAGGGAAGG + Intergenic
1189266218 X:39718618-39718640 CTGGGGAGAAGGGACAAGCAGGG + Intergenic
1190188945 X:48259588-48259610 GTGGGGAGAGGGGGAAGGGATGG - Intronic
1190212861 X:48461411-48461433 CTGGTGATATGGGGATAGGGAGG - Intronic
1190594367 X:52038041-52038063 GTTGGAATAAGGGGAAAGAAGGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191906597 X:66098973-66098995 CTGGGAATTGGGGGGAAGGATGG - Intergenic
1192057177 X:67784879-67784901 GTGGGGGTGAGGGAAAAGGAAGG - Intergenic
1192220127 X:69192069-69192091 CTGGGGGAAAGGGGCAAGGGGGG + Intergenic
1192639777 X:72850741-72850763 CTGGCTCTCAGGGGAAAGGAAGG + Intergenic
1192641934 X:72870064-72870086 CTGGCTCTCAGGGGAAAGGAAGG - Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193624857 X:83805656-83805678 CTAGAGAGAAGAGGAAAGGAAGG - Intergenic
1193882670 X:86943441-86943463 CTGGAGATAATGGGATAGAATGG - Intergenic
1194226675 X:91269070-91269092 CCGGGGGTTAGGGGAAAGTAGGG - Intergenic
1194698991 X:97090890-97090912 CTGGGGAGAAGGGTAAACAATGG - Intronic
1194888499 X:99348563-99348585 CTGGGTATAAGTGGCAAGGGTGG + Intergenic
1195006512 X:100690675-100690697 CTGGGTAGAAGGGGAAGGGTAGG - Intronic
1195057084 X:101156655-101156677 CTGGGGACTCGGGGAAAGGGTGG - Intronic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195494940 X:105520218-105520240 CTGGGTATAAAGTGATAGGAAGG - Intronic
1197319610 X:125011153-125011175 CTTTGTATAAGGGGTAAGGAAGG - Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198031624 X:132758843-132758865 CAGCTGAAAAGGGGAAAGGAGGG - Intronic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198417364 X:136434245-136434267 ATGTGGAGAAGAGGAAAGGAAGG - Intergenic
1198648984 X:138840059-138840081 CTGGGGACAAGGGTAAAGAAAGG + Intronic
1199204633 X:145134452-145134474 ATAGGGAAGAGGGGAAAGGAGGG + Intergenic
1199616015 X:149656784-149656806 CTCGGGATAAAGGGGATGGAAGG - Intergenic
1199626626 X:149746464-149746486 CTCGGGATAAAGGGGATGGAAGG + Intergenic
1201766791 Y:17579926-17579948 CTCGGGAACAGGAGAAAGGAAGG + Intergenic
1201834762 Y:18326059-18326081 CTCGGGAACAGGAGAAAGGAAGG - Intergenic
1202166677 Y:21996426-21996448 CTTGTGATAAGCGAAAAGGAAGG + Intergenic
1202224682 Y:22589947-22589969 CTTGTGATAAGCGAAAAGGAAGG - Intergenic
1202318432 Y:23605713-23605735 CTTGTGATAAGCGAAAAGGAAGG + Intergenic
1202335424 Y:23804175-23804197 CTTTGCATAAGGTGAAAGGATGG - Intergenic
1202379399 Y:24262418-24262440 TTGGGGAAGTGGGGAAAGGAGGG - Intergenic
1202491383 Y:25407703-25407725 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic
1202535343 Y:25865884-25865906 CTTTGCATAAGGTGAAAGGATGG + Intergenic
1202552335 Y:26064344-26064366 CTTGTGATAAGCGAAAAGGAAGG - Intergenic