ID: 965340357

View in Genome Browser
Species Human (GRCh38)
Location 3:167483183-167483205
Sequence TATCTCATACTGCTGGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965340357 Original CRISPR TATCTCATACTGCTGGTATT AGG (reversed) Intronic
901577950 1:10216051-10216073 TATTTCATATGGCTGCTATTAGG - Intronic
901759639 1:11462348-11462370 TATTTCATACTCCTGGCACTGGG - Intergenic
903086705 1:20867361-20867383 TATCTCATTCTGCAGGTGTAGGG - Intronic
903228603 1:21907968-21907990 TATCTCATACGGCTGTTGTGAGG + Intronic
906081243 1:43089914-43089936 TTTCTCATGCTCTTGGTATTCGG + Intergenic
909471675 1:76035895-76035917 TATCTCATAGGGCTGTTGTTAGG + Intergenic
913353453 1:117889475-117889497 TATCAAATGCTGGTGGTATTGGG - Intronic
916278246 1:163019290-163019312 TATCTCATTTTGCTGGTCCTGGG + Intergenic
917014694 1:170516791-170516813 TGGCTAATACTGCTGGAATTGGG - Intergenic
917578669 1:176350321-176350343 TATCTCAGGCTGATGGTACTAGG + Intergenic
920033375 1:203050302-203050324 TATCTCCTAATGCTTGAATTAGG + Intronic
921395797 1:214668091-214668113 TATCTCATAATGCTGAGGTTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923102172 1:230825486-230825508 TATGTCATACGGTTGGTATGAGG - Intergenic
923543331 1:234905730-234905752 TATCTAACACTGCTTGTGTTTGG + Intergenic
924267223 1:242295190-242295212 TACCTCATAATGCTGGGGTTCGG + Intronic
1066717599 10:38303316-38303338 TACCTCATAATGCTGGGGTTTGG - Intergenic
1068133747 10:52929078-52929100 TTTCACATACTGCTGGCCTTTGG - Intergenic
1068315171 10:55332486-55332508 TATCTCATATTGATGACATTTGG + Intronic
1070199371 10:74188606-74188628 CCTCTCAAAGTGCTGGTATTAGG + Intronic
1071801202 10:89063159-89063181 TATCAGACACTGCTGGTATGGGG - Intergenic
1075523124 10:123156536-123156558 TAACTTATACTGCAGGTATTGGG + Intronic
1079378783 11:19918283-19918305 TGTCTCAAACTACTGGTATCTGG + Intronic
1079420480 11:20282104-20282126 TATCTCATACCGTTTTTATTAGG - Intergenic
1079671892 11:23181119-23181141 TATCTTAGACTGCTGGTAAAAGG + Intergenic
1082255447 11:50028339-50028361 GTTCTCATACTGCTGCTATAAGG - Intergenic
1085951898 11:81342456-81342478 AATCTCAAACTCCTGGTTTTAGG + Intergenic
1088143067 11:106641449-106641471 CATCTCATGCTGTTGTTATTGGG + Intergenic
1089495250 11:118905048-118905070 TATCTCATAGGGTTGGTATGAGG - Intronic
1092120434 12:6039881-6039903 TCTCCCAAACTGCTGGTATTAGG - Intronic
1092606137 12:10121742-10121764 CATCTCAAACTTCTCGTATTGGG - Intronic
1099240791 12:80135936-80135958 TATAGCAGACTGCTGGTCTTTGG + Intergenic
1099326573 12:81223536-81223558 TAACTCATAGTGCTGTTATAAGG - Intronic
1100674259 12:96848935-96848957 TATCTATTATTGCTGGTATTGGG + Intronic
1101126155 12:101635482-101635504 TATTTAATATTACTGGTATTAGG + Intronic
1107675430 13:42791725-42791747 TATTTCATAATGCTGGGGTTTGG + Intergenic
1108908061 13:55504001-55504023 TATCTCACAGAGTTGGTATTTGG - Intergenic
1109714666 13:66205713-66205735 TATCTCCTAATGCTAGCATTAGG + Intergenic
1109714667 13:66205718-66205740 TATCTCCTAATGCTAGCATTAGG - Intergenic
1109832359 13:67808066-67808088 GATGTCACACTGCTGGTTTTTGG + Intergenic
1110646236 13:77888214-77888236 TATCTTATACTTCTGGGACTTGG - Intergenic
1111064846 13:83076414-83076436 TATTTTATGCTGCTGGTGTTTGG - Intergenic
1118959259 14:70513882-70513904 TATCTCATACTGATGGGATTGGG - Intergenic
1119105232 14:71917142-71917164 TACCACATGCTTCTGGTATTAGG + Intergenic
1120802518 14:88707454-88707476 TATCTCCTCCTCCTGGTATGTGG + Intronic
1125209362 15:37194955-37194977 TATTGCATAATGCTGGGATTTGG - Intergenic
1127548648 15:60015173-60015195 TATTTCATAAAGCTGTTATTGGG - Intronic
1138209459 16:55151317-55151339 TTTCTCATATTGTTGGTATCTGG + Intergenic
1142848339 17:2692602-2692624 TACCTCATGCTGCTGGTGTTCGG - Exonic
1147026197 17:37586409-37586431 GATCTCTTACTGCTGCTCTTCGG + Exonic
1148650257 17:49245256-49245278 TCTCTCAAAGTGCTGGGATTTGG - Intergenic
1149205538 17:54241276-54241298 TATTTTATACTTCTGGAATTTGG - Intergenic
1149719801 17:58831617-58831639 TATCTCAGACAGCGGGTATAAGG - Intronic
1150031751 17:61744732-61744754 TATCTCATAGAGCTGTTATGGGG + Intronic
1150327257 17:64267113-64267135 TATCCCAAAGTGCTGGGATTAGG + Intergenic
1150535918 17:66040704-66040726 TGTCTCAAACTGCTGGTCTCAGG + Intronic
1153812036 18:8760340-8760362 CACCTCATATTGGTGGTATTAGG + Intronic
1154989188 18:21584121-21584143 TTTCTCCTACTCCTGGTACTTGG - Intronic
1156511207 18:37638256-37638278 TTCCTCATTTTGCTGGTATTTGG + Intergenic
1157500078 18:48184153-48184175 TATGTCAGACTGGTGGTCTTCGG - Intronic
1158732440 18:60038909-60038931 TTTATCATAGTGGTGGTATTTGG + Intergenic
1165908184 19:39206527-39206549 TACCTCAGAGTGCTGGTATAAGG + Intergenic
929028092 2:37624749-37624771 TTTCTTATACTTCTGGTAGTAGG + Intergenic
929059616 2:37910013-37910035 TTTCTCATGCTGCTGGCCTTGGG + Intergenic
929203532 2:39263736-39263758 TATCTCAGAATGCTGGTAAGAGG + Intronic
931465691 2:62484880-62484902 TATCTCATTCTGCTTGTCTGAGG - Intergenic
933345263 2:81076571-81076593 TTTCTCACACTTCTGGTATATGG + Intergenic
935409673 2:102747782-102747804 TATCTGACACTGCTATTATTAGG + Intronic
935538568 2:104323041-104323063 TATCTCATACTGTTGGTAGGAGG + Intergenic
937498807 2:122454878-122454900 TATCTCGTAGGGCTGGTCTTTGG - Intergenic
939295611 2:140260392-140260414 CATCTCTTATTGCTGGAATTTGG - Intronic
939345472 2:140961070-140961092 TATCTCATATTGTTGGCATGAGG - Intronic
939492649 2:142895077-142895099 TATTTCATACTTCTGTCATTAGG - Intronic
940594586 2:155773658-155773680 TATCACATACTGGTGGGAATTGG - Intergenic
941157755 2:161999966-161999988 AAACTCATACTGCTGGTAAGTGG + Intronic
941167300 2:162096565-162096587 CATCTCAATGTGCTGGTATTTGG - Intergenic
941769575 2:169330336-169330358 CATCTCATTCTGCTGCCATTTGG - Intronic
942336490 2:174892496-174892518 TTTCTCATACTACTGGCATCTGG - Intronic
944374324 2:199023823-199023845 TATTTTAGACTCCTGGTATTGGG - Intergenic
945684109 2:212948586-212948608 TACCTCATAGTGCTGCTATGAGG + Intergenic
947399684 2:229718645-229718667 TACCTCATCATGCTGGCATTAGG - Intergenic
1169229217 20:3875931-3875953 TATCACATACAGCTGGAAATCGG + Exonic
1169542576 20:6616439-6616461 TTTCTCATACTTCTGGTCATTGG + Intergenic
1169754367 20:9027502-9027524 TATCTTCTACTGCTGGTGTTCGG - Intergenic
1169841135 20:9939134-9939156 TATCACATACTGCTTTTAATAGG + Intergenic
1170277974 20:14614245-14614267 TTTCTCATAATGCTGTTATGAGG + Intronic
1171724903 20:28607377-28607399 TATCTCATAATGCTGACTTTTGG - Intergenic
1171753168 20:29075673-29075695 TATCTCATAATGCTGAGTTTTGG + Intergenic
1171789092 20:29501886-29501908 TATCTCATAATGCTGAGTTTTGG - Intergenic
1171858437 20:30372611-30372633 TATCTCATATTGCTGAGTTTTGG + Intergenic
1172789456 20:37492643-37492665 TATATCATACTCCTTGTATCAGG - Intronic
1174430889 20:50467996-50468018 TATGGCATAGTGCTGTTATTGGG + Intergenic
1174545013 20:51318609-51318631 TGTTTCACGCTGCTGGTATTTGG + Intergenic
1175021649 20:55857458-55857480 TATCTAATACTGCAGCTATATGG + Intergenic
1177091793 21:16778531-16778553 TTCCTAATATTGCTGGTATTTGG + Intergenic
1177106018 21:16956451-16956473 TATTGCATAATGCTGGCATTTGG - Intergenic
1177502087 21:21969677-21969699 TATCACATACTGCGGGTCTCTGG + Intergenic
1177780380 21:25615911-25615933 TGTTCCATACTGATGGTATTTGG + Intergenic
1178777910 21:35569737-35569759 TATTACATTTTGCTGGTATTTGG - Intronic
1180298453 22:10966068-10966090 TATCTCATAATGCTGAGTTTTGG - Intergenic
1180409960 22:12597733-12597755 TATCTCATAATGCTGAGTTTTGG + Intergenic
1183528261 22:38336804-38336826 TATCTGAGACTGCTTGTATTTGG + Intronic
949327059 3:2878447-2878469 TTTCCCATATTACTGGTATTGGG + Intronic
952045093 3:29309498-29309520 TTTGTCATTTTGCTGGTATTTGG + Intronic
955135176 3:56210030-56210052 TATCTCCCACTGATGATATTGGG - Intronic
957023586 3:75152702-75152724 TATTGCATAATGCTGGGATTTGG + Intergenic
959494642 3:107036104-107036126 GATCTCATACTCCTGGAACTTGG - Intergenic
959756309 3:109903918-109903940 TTTCTCATAATGCTGATATGAGG - Intergenic
961621985 3:128231565-128231587 AAGATCATACTGCTGGTATGTGG + Intronic
962221580 3:133568813-133568835 TCTCTGAGACTGCTGATATTGGG - Intergenic
964497515 3:157308870-157308892 TATCTCATAGTGTTGTCATTGGG + Intronic
965340357 3:167483183-167483205 TATCTCATACTGCTGGTATTAGG - Intronic
966092622 3:176158741-176158763 TATTTTCTACTCCTGGTATTCGG - Intergenic
968280752 3:197474947-197474969 TATCTCCTACTGGAGATATTTGG - Intergenic
969548777 4:7850334-7850356 TATGTAATGCTGCTGGTGTTTGG - Intronic
970476521 4:16429352-16429374 TATTGCATAATGCTGGTGTTTGG + Intergenic
970776882 4:19685300-19685322 TATCTCATAATGCTTGTTTAAGG + Intergenic
971086199 4:23278289-23278311 TATTGCATAATGCTGGAATTTGG - Intergenic
972991729 4:44829055-44829077 TATCTCACACAGTTGTTATTAGG - Intergenic
973735901 4:53871463-53871485 TATCTCATAGTGTTGTTATGAGG + Intronic
974750735 4:66137580-66137602 TATCTAATCCTGCTTGAATTTGG - Intergenic
978119232 4:105058562-105058584 TATCATTTACTGCAGGTATTGGG - Intergenic
978451985 4:108844187-108844209 AATCTTATTCTGCTGGTATCAGG + Intronic
979022015 4:115514034-115514056 GTTCTCATAGTGCTTGTATTAGG - Intergenic
979226877 4:118296140-118296162 TATCTCCTGCTGCTGCTATTTGG + Intronic
980385135 4:132079182-132079204 TATCACATATTTCTGTTATTTGG - Intergenic
982549295 4:156777380-156777402 TATCTCAGAATGCCTGTATTTGG + Intronic
982958187 4:161798613-161798635 AATCACAAACTCCTGGTATTTGG + Intronic
983594023 4:169445768-169445790 TATCGCATAATGCTGAGATTTGG - Intronic
983886405 4:172985125-172985147 CATCTCATATTGCTGGAATTGGG - Intronic
984052687 4:174886034-174886056 TATCTCTCACTGCTCTTATTTGG - Intronic
984181796 4:176492376-176492398 TATCTAACACTGCTTGTGTTTGG - Intergenic
984397022 4:179214988-179215010 TATCTCACACTGCGGGTCATAGG - Intergenic
985436571 4:189936332-189936354 TATCTCATAATGCTGAGTTTTGG + Intergenic
989324511 5:40175576-40175598 CATCTCATACTGATTGTTTTTGG - Intergenic
990159335 5:52919555-52919577 TTTCTCATTCTGCTTGTATTTGG - Intronic
990741032 5:58913096-58913118 TATCCCAGACTACTGTTATTTGG + Intergenic
992607355 5:78472455-78472477 TAATTCATACTGCTGATATCAGG - Intronic
995279809 5:110321068-110321090 AATCTCATTCTGCTTATATTTGG - Intronic
996676843 5:126185820-126185842 TATCTCATAGTGCTTTTATTTGG - Intergenic
997839435 5:137225758-137225780 TGTCTAATACTGCTGGTACAGGG + Intronic
999111958 5:149129219-149129241 TATCCCATTCTGCTGGTTTCAGG + Intergenic
999473172 5:151874327-151874349 TATTGCATAATGTTGGTATTTGG - Intronic
1001539032 5:172524173-172524195 TATCTCATACAGCTGCTGTGAGG + Intergenic
1008129273 6:47702053-47702075 GATCTCAAACTCCTGGTCTTAGG + Intronic
1008196699 6:48533296-48533318 TATCTCATAATCCAGATATTTGG + Intergenic
1009518110 6:64645459-64645481 TATTTCATACTGCTGTTTCTTGG - Intronic
1013982467 6:116148140-116148162 TATCTCATATTCCTTGTATAAGG + Intronic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1018723526 6:166592134-166592156 TTTCTCTTTCTGCTGGTATTTGG - Intronic
1023347152 7:39282620-39282642 TATTTCATTCTGTTGGTCTTGGG + Intronic
1026539011 7:71264013-71264035 TAGGTGATACTGCTGGTCTTGGG + Intronic
1028213653 7:88105955-88105977 TATCTCATAGGGCTGTTATGAGG - Intronic
1029875968 7:103752146-103752168 TATCTCATAGGGTTGGTATAAGG - Intronic
1032419667 7:131767945-131767967 TAACTCATACTGCTGTTCTGAGG + Intergenic
1032688735 7:134261198-134261220 TATATCATACTGCTGGCTCTGGG + Intronic
1034044470 7:147913221-147913243 TCTCTCATACTGCTGGCACAAGG + Intronic
1038625504 8:29189310-29189332 TAACTTATACTTCTGATATTGGG + Intronic
1039000115 8:32970626-32970648 TATCTTATTCTGCTGGTCCTGGG - Intergenic
1039067948 8:33625545-33625567 TATCTCTAAGTGCTGGGATTTGG - Intergenic
1041589322 8:59558755-59558777 TATGTGAAATTGCTGGTATTAGG + Intergenic
1045340517 8:101250496-101250518 TATCTCATACAGTTGTTATTAGG + Intergenic
1048850872 8:138644163-138644185 TATTTGACACTGCTGGAATTTGG + Intronic
1051122559 9:13767662-13767684 ATTCTAATACTGCTTGTATTTGG - Intergenic
1051612085 9:18970989-18971011 TGTCTCATGCTGCAGGTAATGGG + Intronic
1053724698 9:40987802-40987824 TATCTCATATTGCTGAGTTTTGG + Intergenic
1059806288 9:117804408-117804430 AAGCTCATACTGCTGGTCCTTGG + Intergenic
1060583714 9:124772656-124772678 TATCTCATAGAGCAGGTATGAGG - Intergenic
1061752218 9:132787171-132787193 TCTCTGAAACTGCTGTTATTTGG - Intronic
1203784423 EBV:119507-119529 CATCTATTACTGCTGCTATTTGG - Intergenic
1203450109 Un_GL000219v1:104193-104215 TATCTCATAATGCTGAGTTTTGG - Intergenic
1185754433 X:2642276-2642298 GATCTCAGACTTCTGGTCTTTGG - Intergenic
1186202968 X:7172525-7172547 TATCTCAGGCTGCTGTCATTTGG + Intergenic
1187726954 X:22213209-22213231 TAACTCATACTACCAGTATTTGG + Intronic
1188023237 X:25181501-25181523 TTTTTCATGCTGCTGGCATTGGG + Intergenic
1188106514 X:26154017-26154039 TATCTCATACTGGTTTTAATTGG + Intergenic
1188519947 X:31027350-31027372 TTTCTCATTCTGCAGGTCTTGGG + Intergenic
1188683470 X:33040679-33040701 TCTGTCATACTGCTAGTATGGGG - Intronic
1190110265 X:47584981-47585003 GATCTCATAACGCTGGTATAAGG - Exonic
1195226487 X:102799871-102799893 TACCTCATACTTCTGGGGTTGGG - Intergenic
1195800628 X:108705256-108705278 TATCTCATTGTGGTGGTTTTTGG + Intergenic
1195998182 X:110752418-110752440 TTTCTCATACTGTTGGTCCTTGG - Intronic
1196911289 X:120487069-120487091 TAGCTCACACAGCTGGTATATGG - Intergenic
1201355683 Y:13094650-13094672 TTACTCATACTGCTGGTGGTAGG - Intergenic
1201688215 Y:16731552-16731574 AATCTCAAAGTGATGGTATTAGG - Intergenic
1201860406 Y:18591660-18591682 TCTCTAAAACTGCTGTTATTTGG - Intergenic
1201872917 Y:18728721-18728743 TCTCTAAAACTGCTGTTATTTGG + Intergenic