ID: 965341192

View in Genome Browser
Species Human (GRCh38)
Location 3:167493302-167493324
Sequence ATCTGATACCACTCCATGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965341187_965341192 0 Left 965341187 3:167493279-167493301 CCCCTGTCAGCAGTATGCCACCT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73
965341184_965341192 23 Left 965341184 3:167493256-167493278 CCAGAACCCAGAGCTAGCAGTTT 0: 1
1: 0
2: 0
3: 17
4: 139
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73
965341186_965341192 16 Left 965341186 3:167493263-167493285 CCAGAGCTAGCAGTTTCCCCTGT 0: 1
1: 0
2: 1
3: 12
4: 137
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73
965341185_965341192 17 Left 965341185 3:167493262-167493284 CCCAGAGCTAGCAGTTTCCCCTG 0: 1
1: 0
2: 2
3: 19
4: 150
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73
965341189_965341192 -2 Left 965341189 3:167493281-167493303 CCTGTCAGCAGTATGCCACCTAT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73
965341188_965341192 -1 Left 965341188 3:167493280-167493302 CCCTGTCAGCAGTATGCCACCTA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965341192 Original CRISPR ATCTGATACCACTCCATGAA CGG Intronic
906148250 1:43572623-43572645 GCCTGAGTCCACTCCATGAAGGG - Intronic
910115182 1:83724045-83724067 ATCTGATACAGCACCATGAGAGG + Intergenic
916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG + Intronic
1064965388 10:21010949-21010971 ATCTGAGACCAGTCCAGGGAAGG + Intronic
1065185531 10:23166899-23166921 ATATGCTTCCACTCCATAAAGGG + Intergenic
1070713080 10:78697547-78697569 ATTTGATTCCTCTCCTTGAATGG + Intergenic
1080355414 11:31438871-31438893 ATATTATACCACTTCATGTAAGG + Intronic
1080926988 11:36767862-36767884 TTCTGATACCACACCCTGAGCGG - Intergenic
1090476013 11:127021017-127021039 ATCTAAGACCACACAATGAAAGG + Intergenic
1090595701 11:128319013-128319035 ATCGCATACCACTTCCTGAAGGG - Intergenic
1097519147 12:60646228-60646250 ATCAGATTTCCCTCCATGAAAGG - Intergenic
1099873296 12:88374512-88374534 ATCTAATCCCACTCCACTAAGGG + Intergenic
1100207820 12:92370086-92370108 ATATGATACCTGTCCATGACTGG + Intergenic
1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG + Intronic
1106508432 13:30392075-30392097 ATCTGATACCATTTCTTGACTGG - Intergenic
1110633018 13:77731803-77731825 ATCTGATTTCCCACCATGAAAGG - Intronic
1114270053 14:21095136-21095158 ATGTGGTAAAACTCCATGAAGGG + Intronic
1125231046 15:37455771-37455793 ATCTGATATAACTCAATGAAGGG - Intergenic
1129533698 15:76292386-76292408 ATCTGATATCACTGCTTGAAAGG - Intronic
1134189986 16:12113565-12113587 ATATGATACCACAGCCTGAAGGG + Intronic
1135817841 16:25652231-25652253 ATCTGTTTGCACTCCATGGATGG + Intergenic
1137233045 16:46585986-46586008 CTCTGATACTACTACAAGAAGGG - Intronic
1137916019 16:52431055-52431077 CCCTGATAGCACTTCATGAAGGG - Intergenic
1139842874 16:69895843-69895865 ATCTGATGCTACTCAAAGAATGG - Intronic
1143995524 17:11003380-11003402 ATCAGAAAACACTCCATGGAAGG + Intergenic
1154100077 18:11464701-11464723 TTCTGACACCACCCCATGGAGGG + Intergenic
1166257490 19:41616934-41616956 ATCTGCTGCCACTCCCTGCAGGG - Intronic
1166409679 19:42548131-42548153 ATCTGTTGCCACTCCCTGCAGGG - Intronic
928625264 2:33133372-33133394 TTCTGACGCCACTCCATGACTGG - Intronic
930032874 2:47069158-47069180 ACCTGATACCAGCCCAGGAAGGG + Intronic
931744897 2:65283270-65283292 ATCTCATTCCACTGGATGAAGGG - Intergenic
938392920 2:130918932-130918954 GTCTAATCCCACTCCATGCAAGG + Intronic
941509704 2:166390380-166390402 ATTTGAAACAACTCTATGAAGGG + Intergenic
942183007 2:173398302-173398324 ATCTGATATTACTCCTAGAATGG - Intergenic
945631400 2:212282612-212282634 ATTTTATACCACTTCATGAGTGG + Intronic
1181667506 22:24408318-24408340 AACAGTTACCACTCCATAAAGGG - Intronic
955969540 3:64424238-64424260 GTCTGATGCATCTCCATGAATGG + Intronic
956302786 3:67790686-67790708 ACCCAATATCACTCCATGAAGGG - Intergenic
957341890 3:78910473-78910495 ATCTGATTCAACTCCTAGAAGGG + Intronic
959488371 3:106955756-106955778 CTCTGATACCACCCCTAGAAGGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961904980 3:130253633-130253655 GTCTGAGACAACTCCATGGATGG - Intergenic
964209496 3:154211365-154211387 AGCTGATACCCATCCATGGAGGG - Intronic
965019328 3:163207236-163207258 ATCAGATCCCACTTTATGAAGGG - Intergenic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
969834259 4:9826756-9826778 ATGTGATAACACTTCATGTAGGG - Intronic
969941024 4:10731754-10731776 AACTGATACTACTACATGTATGG - Intergenic
976283014 4:83344022-83344044 ATCTGAGGCCAGTCTATGAAAGG + Intergenic
980711247 4:136571362-136571384 TTCTCATATCACTCCATGAATGG + Intergenic
982317777 4:154048553-154048575 ATCTTATACCATTCTAGGAAGGG + Intergenic
993643713 5:90436795-90436817 TTCTGATACTACTGAATGAATGG - Intergenic
998736546 5:145148294-145148316 ATCTGTCACGACTCAATGAATGG + Intergenic
998917659 5:147033324-147033346 ATTTGATGTCACTCCATGGAGGG + Intronic
1001665135 5:173426510-173426532 AACCCATAGCACTCCATGAAAGG - Intergenic
1003671940 6:8167520-8167542 ATCTGATACAGCTCCAGGAAAGG - Intergenic
1007729198 6:43935559-43935581 ATTTGAGAGCCCTCCATGAAAGG + Intergenic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1011867522 6:91848924-91848946 AAGTGAAACCAGTCCATGAATGG + Intergenic
1012627153 6:101418374-101418396 ATCTAGTACCAGTCCATAAAAGG - Intronic
1019050072 6:169176137-169176159 ATCACAAACCTCTCCATGAATGG - Intergenic
1021229501 7:18068806-18068828 AACTGATACAATTACATGAAAGG - Intergenic
1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG + Intronic
1024713119 7:52040253-52040275 CTCTGATACCACTCCACCAGGGG - Intergenic
1027235966 7:76297944-76297966 ATCTGAGATCACTCCTGGAAAGG - Intergenic
1033438958 7:141361214-141361236 TTCTGATACAACTCCAGTAAAGG - Intronic
1043524610 8:81083054-81083076 CTCTGTTACCACTCCCAGAAGGG + Intronic
1044931605 8:97257459-97257481 ATCTGAAACAACTGAATGAAGGG + Intergenic
1047828428 8:128604653-128604675 ATATGATACCACTTTGTGAAAGG - Intergenic
1055929077 9:81541121-81541143 TTCTGATACCACTACATTAGGGG - Intergenic
1059035656 9:110751233-110751255 ACCTGATCCAACTCCATAAACGG + Intronic
1192733146 X:73821123-73821145 AGCTGATACCACACATTGAAAGG + Intergenic
1194025332 X:88744748-88744770 CTCTCATACCATACCATGAAAGG - Intergenic
1194348188 X:92792943-92792965 AGCTGATGCCTGTCCATGAAGGG + Intergenic
1197435754 X:126425882-126425904 AGCTGATGCCAACCCATGAAGGG - Intergenic
1198189596 X:134288825-134288847 ATCTCTTACCACTCCATGCCTGG + Intergenic
1199177589 X:144810189-144810211 AGCTGATGCCTGTCCATGAAGGG + Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic
1200656518 Y:5909572-5909594 AGCTGATGCCTGTCCATGAAGGG + Intergenic
1201545824 Y:15160900-15160922 AGCCCATACCAGTCCATGAAAGG + Intergenic