ID: 965342138

View in Genome Browser
Species Human (GRCh38)
Location 3:167503710-167503732
Sequence TGGCCAGCAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 3, 2: 53, 3: 136, 4: 474}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965342130_965342138 13 Left 965342130 3:167503674-167503696 CCAGAGGGATGGAAGTCAGCGGT 0: 10
1: 44
2: 108
3: 118
4: 166
Right 965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG 0: 1
1: 3
2: 53
3: 136
4: 474
965342127_965342138 23 Left 965342127 3:167503664-167503686 CCTGCCAGATCCAGAGGGATGGA 0: 12
1: 36
2: 99
3: 152
4: 348
Right 965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG 0: 1
1: 3
2: 53
3: 136
4: 474
965342128_965342138 19 Left 965342128 3:167503668-167503690 CCAGATCCAGAGGGATGGAAGTC 0: 25
1: 61
2: 115
3: 90
4: 155
Right 965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG 0: 1
1: 3
2: 53
3: 136
4: 474
965342125_965342138 24 Left 965342125 3:167503663-167503685 CCCTGCCAGATCCAGAGGGATGG 0: 13
1: 43
2: 96
3: 162
4: 295
Right 965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG 0: 1
1: 3
2: 53
3: 136
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965342138 Original CRISPR TGGCCAGCAGCAGTGGTGGA GGG Intronic
900289005 1:1915939-1915961 TGGGCAGCAGCAGTGGTGGCAGG + Intronic
900410723 1:2511302-2511324 TCCCCAGCAGCAGAGGTGGGAGG + Intronic
900428569 1:2591677-2591699 TGGCCAGGAGGGGTGGGGGAGGG + Intronic
900463676 1:2813412-2813434 GGGCCAGCAGCTGCGGAGGAGGG + Intergenic
900514983 1:3077375-3077397 AGTCCAGCAGCAGTGAGGGAGGG - Intronic
900703994 1:4067655-4067677 TGGCCAGGAGCAGAGGGGCATGG + Intergenic
901653427 1:10755862-10755884 TGGCCTGCAGCTGGGGTGGGGGG - Intronic
902225238 1:14992512-14992534 TGGCCAACAGCCCTGGAGGAGGG - Intronic
903266997 1:22163575-22163597 GGGCCAGGAGCAGTGGGGGCAGG + Intergenic
903305076 1:22407665-22407687 TTGCCAGCAGCAGAGGGGCAGGG + Intergenic
905862037 1:41358286-41358308 GTGGCAGCAGCAGTGGTGGCAGG + Intergenic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
906532500 1:46531795-46531817 AGGGCAGCAGTAGTGGTTGAGGG - Intergenic
906684776 1:47756283-47756305 AGACCAGCAGCACAGGTGGAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911063402 1:93766559-93766581 TGGCCAGCAGCGGCTCTGGACGG - Intronic
911739378 1:101370268-101370290 TGTCCAACAGCAGCAGTGGAGGG - Intergenic
912690914 1:111804138-111804160 TGGGCAGCAGCAGGGGTTGGGGG - Intronic
914353130 1:146857433-146857455 TAGCCAGCAGAAGCTGTGGATGG + Intergenic
915083163 1:153365927-153365949 TGGCCACCAGCAGGGGCGGCAGG + Intergenic
915458316 1:156054586-156054608 AGGACAGCAGCAGCGCTGGAAGG - Intergenic
916212892 1:162373007-162373029 TGGCCAGCAGGTGGTGTGGAGGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918045670 1:180939550-180939572 AGGCCAGGAGAAGTGGTGGGAGG - Intronic
918058181 1:181040635-181040657 TGGGCTGAACCAGTGGTGGATGG + Intronic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
918120088 1:181530710-181530732 TGGCCAGCAGAAGGGATGGGAGG - Intronic
918418183 1:184334221-184334243 TGGCCAGGAGGAGTGGGGAATGG + Intergenic
918423356 1:184386240-184386262 TGGACGGATGCAGTGGTGGATGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919833265 1:201556693-201556715 GGGCCAGCAGCAGAGGTCTAAGG + Intergenic
920365223 1:205444718-205444740 TGGGCGGCAGCGGGGGTGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921100394 1:211923755-211923777 TGCGCAGTAGCAGTGGTGGTGGG - Intergenic
921961595 1:221040890-221040912 TGGCCAGAGGCAGTTTTGGATGG + Intergenic
922180121 1:223226909-223226931 TTGCCAGCAGTAGTGCTGGGTGG + Intronic
922302710 1:224316695-224316717 TGCCTAGAAGCAGGGGTGGAGGG + Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923031881 1:230255627-230255649 TGGCCAGGAGCTGTGATGGCAGG + Intronic
923500714 1:234561339-234561361 TGGGCAGTAGGAGTGGTAGAGGG + Intergenic
1062896382 10:1106339-1106361 TGGAGAGCAGCACTGGTGGGAGG - Intronic
1063257160 10:4340881-4340903 AGTCCAGCAGCACTGGTGGTGGG + Intergenic
1064564280 10:16624355-16624377 TGGGCAGCCACAGAGGTGGAAGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066144342 10:32541224-32541246 TGGCTACCAGCAGTGGGGGTGGG + Intronic
1066228441 10:33407809-33407831 TGACCAGAGACAGTGGTGGAGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067299242 10:44994065-44994087 TGCCCAGCAGCAGCTCTGGAAGG + Exonic
1067529452 10:47059840-47059862 TCGCCACCAGCAGTGGGGGGTGG + Intergenic
1067720026 10:48721280-48721302 TGGACAGTTGCTGTGGTGGAAGG + Exonic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069781768 10:70961424-70961446 TGGCCAGAAGCGGCGGTGGCTGG - Intergenic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072740616 10:97906947-97906969 TGGCCTGCAGGAGTGGTGAGTGG - Intronic
1074406849 10:113187321-113187343 AGCCCAGCAGCAGGGGTGGGAGG - Intergenic
1074460299 10:113630568-113630590 TAGTCAGCAGTAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075634082 10:124018592-124018614 TGGCCAGCTTCAGAGGAGGAGGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077305940 11:1868724-1868746 GAGCCAGCAGCAGGGGTGCAGGG + Intronic
1077370017 11:2177449-2177471 TGGGCAGCAGCAGTAGCAGAAGG - Intergenic
1077574729 11:3373995-3374017 TGGCCAGAATCAGTGATGGGGGG - Intronic
1077850265 11:6069291-6069313 TCCTCAGCAGCTGTGGTGGAAGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080583044 11:33658925-33658947 GGCACAGCAGCAGTGGTGGGGGG - Intronic
1080749791 11:35141217-35141239 TAGCCAGGAGCAGTGCTGGATGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081274184 11:41126620-41126642 AGGCCAGAATCAGTGTTGGAAGG - Intronic
1081720797 11:45286640-45286662 TGGCCAGCTGCTGGGGTAGAAGG - Intergenic
1083082371 11:60107612-60107634 TGGCCAGCAGTAGAGGTAGGTGG - Intergenic
1083225462 11:61281750-61281772 TGGCCAGCCGCCGGGATGGAGGG + Intronic
1083622031 11:64053906-64053928 GGGCCAGCAGAGGTGGTGGGGGG - Intronic
1083664526 11:64267340-64267362 GGGCCAGCAGCTGTGGGAGAAGG - Exonic
1083778506 11:64906296-64906318 AGGCTAGCAGGAGGGGTGGATGG + Intronic
1083920654 11:65780195-65780217 CCGCCAGCAGCAGTGGCCGACGG + Exonic
1084480144 11:69415315-69415337 TGGCTGGCAGCAGAGGTGGGGGG + Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084768014 11:71324998-71325020 TGGCCAGCAGGAGCGATGGGAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085169886 11:74440695-74440717 TGGCCAGCAGGAGAGGTGGTGGG - Intergenic
1085293731 11:75418461-75418483 TGGGTGGCAGCAGTGGTGGTAGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085692389 11:78674319-78674341 TGGCCACCCACAGTGGTGGCAGG - Intronic
1085753050 11:79178651-79178673 TTGACAGGAGCAGTGTTGGAAGG + Intronic
1086852860 11:91831442-91831464 TGACCAGGAGCAGGGGTGGAGGG + Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1088745650 11:112801893-112801915 TGGCCTGCAGCAGAGGAGGCAGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089270889 11:117300547-117300569 TGGGCAGAGGCAGCGGTGGAGGG + Intronic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1090410141 11:126502350-126502372 TTGCCAGGAGGAGTGGAGGAGGG - Intronic
1090499715 11:127249520-127249542 TGCCCAGCAGCATTGCTGAAAGG - Intergenic
1091686628 12:2567130-2567152 TGGAAAGCAGCTGTGGAGGATGG - Intronic
1092233451 12:6791128-6791150 TGTCTAGCACCAGTGGTGGGAGG - Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092709046 12:11315062-11315084 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093123986 12:15306738-15306760 TGGCCTGGGGCAGTGGTGGCGGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095292100 12:40488560-40488582 TGGCCATCAGCTGTGGTGACAGG + Exonic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099385354 12:82006615-82006637 TGGCCAGGAGAGGAGGTGGAAGG - Intergenic
1099390897 12:82077888-82077910 TGGCCAGGAGCACAGGTGCATGG + Intergenic
1100981900 12:100168605-100168627 TGGCCAGAAGCAGTAGAGAAAGG + Intergenic
1101412188 12:104478783-104478805 TGGCCATCAGCAGCAGTGGCAGG + Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1101747027 12:107550258-107550280 TGGCCAGCATCAGTGGTGTGAGG - Intronic
1102385449 12:112505269-112505291 TTTCCAGCAGCAGAGCTGGAAGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104686254 12:130787138-130787160 AGGCCAGCAGCAGGCCTGGAGGG - Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105730151 13:23205731-23205753 TGGGCAGCTGCAGTGATGGCCGG - Intronic
1106159195 13:27185341-27185363 TAGGTAGCAGCAATGGTGGAGGG - Intergenic
1106319560 13:28624940-28624962 TGGCCATCAGCAGGGATTGAGGG + Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107140440 13:36992950-36992972 TGGCCAGCTGCTCTGCTGGAAGG - Intronic
1108599133 13:51975484-51975506 TGGCCTGCAGCAGAGGCAGAGGG + Intronic
1108716312 13:53081530-53081552 TGGACAGCAGAAGTGGGGAAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110556029 13:76860482-76860504 TGGCCAGGAGAGGTGGTGGTGGG + Intergenic
1110557190 13:76873181-76873203 GGGCCTGGAGCAGTGGGGGATGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111475134 13:88736066-88736088 TGACCAGCAGCAGTGGTCTTAGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112011373 13:95296562-95296584 TGGCCAGCAACAGGGGAGCAAGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1112369968 13:98785626-98785648 TAGCCAGACGCAGTGATGGAAGG - Intergenic
1113100560 13:106713042-106713064 AGGCCAGCAGCCGTGGTCCAGGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113965330 13:114149908-114149930 ATGCCATCAGCAGTGGTGAAGGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117214185 14:53533219-53533241 TGGCCACCAGCAGTGGCGTCTGG + Intergenic
1118909948 14:70053198-70053220 TGGCCACCAGCACTAGAGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119716626 14:76864194-76864216 TGTCCAGCAGCTGTGGAGGATGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120422245 14:84302894-84302916 TGCCCAGCACCAGTGCAGGAGGG - Intergenic
1121613774 14:95299210-95299232 GGGCCTGCGGCAGTGGTGGTGGG - Intronic
1121972003 14:98366972-98366994 TAGCCAGGTGCAGTGGTGCATGG - Intergenic
1122437552 14:101710297-101710319 TGGCCAGCAGGTGTGGTCGGTGG - Intergenic
1122540690 14:102496245-102496267 TGGTCACCAGCAGTGCTGGTGGG - Intronic
1122903576 14:104792008-104792030 TGGCCAGCAGCTGGGTGGGATGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1124415099 15:29467139-29467161 GGAACAGCAGCAGGGGTGGAGGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127692726 15:61413872-61413894 TGCTCACCAGCAGTGTTGGATGG + Intergenic
1127785940 15:62354783-62354805 TGGCCAGCAGCCGTGGCTGCAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128387891 15:67163659-67163681 TGACCAGCAGCAGAGGTTCAGGG - Intronic
1128837062 15:70817649-70817671 TGGCCAGCTCCACTGGTGCAGGG - Intergenic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1129319101 15:74763927-74763949 TGGACAGCAGTAGTGGGGGGCGG + Intergenic
1129598595 15:76983795-76983817 TGGCCCTCAGCAGTGGAGGCAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130123027 15:81068618-81068640 TGTCCAGCAGCAGTGGAGGGGGG + Intronic
1130215871 15:81968926-81968948 TGTCCACCAGCAGTGTAGGAGGG - Intergenic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131249374 15:90820430-90820452 GGGCCAGCAGGAGTTGGGGAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132065996 15:98731853-98731875 TTGCCTGCAGTAGTGGTGGTTGG + Intronic
1132067247 15:98742368-98742390 TAGCCAGCAGGAGTGGTGAGAGG + Intronic
1132094380 15:98971005-98971027 TGGCCAGAGGCAGTGGGGCATGG - Intronic
1132359283 15:101199069-101199091 TGGGCAGCAGCAGTGGGAGCAGG - Intronic
1132694655 16:1196511-1196533 GGGCCAGAAGCAGTGGCGGGTGG - Intronic
1132714477 16:1283949-1283971 TGGCCTGCAGGAGTGGGGAAGGG + Intergenic
1132985833 16:2767117-2767139 AGGCCAGCAGCAGACATGGACGG - Exonic
1133039848 16:3054843-3054865 TGGCCAGAGGCAGAGATGGATGG + Intronic
1133201267 16:4206149-4206171 GGGCCAGGAGCAGAGGGGGAAGG - Intronic
1133231228 16:4367598-4367620 TGGGCCTCAGCAGTGGGGGAAGG + Intronic
1133275309 16:4634655-4634677 TGACCTGGAGCAGTGTTGGAGGG + Intronic
1134002990 16:10797251-10797273 TGGCCAGGCGCAGTGGTTCATGG + Intronic
1134418339 16:14063656-14063678 TGACCAACAGGAATGGTGGATGG - Intergenic
1134610897 16:15607078-15607100 TGGCCAGCAGCATCGCAGGAGGG - Intronic
1136008110 16:27344974-27344996 TGGGCAGCAGCTGCTGTGGAAGG + Exonic
1136010320 16:27359314-27359336 AGGCCAGAAGGAGTGGAGGAAGG + Intronic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1139701684 16:68711615-68711637 TGGCCAGCAGCTGGAGAGGAAGG + Intronic
1139980894 16:70858085-70858107 TAGCCAGCAGAAGCTGTGGATGG - Intronic
1141647498 16:85375486-85375508 TGGGCAGCACCAGTGCTGGTGGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143014550 17:3884663-3884685 TCCCCAGAAGCAGTGGTGAAGGG + Intronic
1143524351 17:7463506-7463528 GGGGCAGTAGCAGTGGTGGAGGG - Exonic
1143934229 17:10465731-10465753 TGTGCAGCAGCAATGATGGAAGG - Intronic
1143980374 17:10864212-10864234 TGGCCAGAAGCTGGGGTGTAGGG - Intergenic
1146970086 17:37065532-37065554 TGGTCAGCAGCTGGGGTGGCAGG + Intergenic
1147535032 17:41315302-41315324 GGGACTGCATCAGTGGTGGAGGG + Exonic
1147557438 17:41488469-41488491 TGTCCAGCTGCAGTGGCTGACGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148793046 17:50184300-50184322 TGGGCTGCAGCTGTGGAGGAGGG + Exonic
1148870632 17:50657033-50657055 TGGCCAGCAGCTGTGCAGGGAGG - Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149295882 17:55262487-55262509 TCCCCAGAAGCAGTTGTGGATGG - Intergenic
1149890630 17:60386385-60386407 TAAACAGCTGCAGTGGTGGAGGG - Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151300766 17:73223738-73223760 TGGCCAGGCCCAGTGGAGGAGGG + Intronic
1151367906 17:73629058-73629080 TGGCCAGCAGCTGCAGTGGGTGG + Intronic
1151454059 17:74215550-74215572 TGCCCAGGAGCAGTGGCCGATGG - Intronic
1151465936 17:74285235-74285257 TGGGGAGCTGCAGTGATGGATGG - Intronic
1151840672 17:76615228-76615250 GGGCCAGCGGGAGTGCTGGATGG - Intergenic
1152032450 17:77852851-77852873 TGGGCAGGAGCTGGGGTGGAGGG + Intergenic
1152108450 17:78343754-78343776 TGGCCCGGAAGAGTGGTGGATGG + Intergenic
1152144274 17:78558818-78558840 TGGACAGAAGCACTGTTGGAAGG - Intronic
1152298093 17:79480040-79480062 TGACCAGGAGCCGTAGTGGATGG + Intronic
1152371838 17:79893077-79893099 AGGCCAGCAGCAGTGGGGGCAGG + Intergenic
1152639026 17:81442061-81442083 CGGCCAGCGGCAGAGGAGGACGG + Exonic
1152887371 17:82860335-82860357 TGGCCTTTCGCAGTGGTGGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154275325 18:12954324-12954346 TGGCCAACAGGAGGGGTGTAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156450611 18:37264355-37264377 AGGCCAGCAGCAATGATTGAGGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1158718213 18:59899665-59899687 TCGTCAGCGGCAGTGGTGGCGGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160666045 19:329153-329175 TGGGCAGGAGCTGGGGTGGAGGG - Intronic
1160868668 19:1267171-1267193 TGGCCAGCAGGGGTGGATGAAGG + Intronic
1161566614 19:5006143-5006165 AGGCCTGCAGCAGGGATGGAAGG - Intronic
1161682277 19:5686342-5686364 TGGCCAGCAGGTGCGGTGGAGGG + Intronic
1161721753 19:5906574-5906596 TGGCCAGCGGCCATGATGGAGGG + Intronic
1161771633 19:6234036-6234058 GGTCCAGCAGCAGGGGTGGGAGG + Intronic
1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG + Intergenic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1162079103 19:8208532-8208554 AGGGCAGCAGCAGTGGGGGCTGG - Intronic
1162141745 19:8589504-8589526 AGGGCGGCAGCCGTGGTGGACGG - Exonic
1162937041 19:13986509-13986531 GGGCCAGACCCAGTGGTGGAGGG - Intronic
1163023195 19:14494926-14494948 TGGCCAGCAGGAGGAGGGGAAGG + Intronic
1163324361 19:16593568-16593590 TGGCCAGCAACCGTGGATGAGGG - Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164517415 19:28948132-28948154 TGCACAGAAGCAGTGGGGGAGGG + Intergenic
1164921498 19:32092005-32092027 TGGCCAGAAGGAGAGGTGGAAGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1167329781 19:48848007-48848029 TGCTCAGCAGCAGCTGTGGATGG - Exonic
1167504453 19:49863748-49863770 TGGCCACCAGCACCTGTGGATGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925038374 2:709636-709658 CTGCCAGAAGCAGTGGTGCACGG + Intergenic
925174081 2:1770219-1770241 TTGCGGGCAGCAGAGGTGGAAGG - Intergenic
927155407 2:20218341-20218363 AGGCCACCAGCAGAGGTGGGAGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929094128 2:38247715-38247737 TGGGCAGCTGGGGTGGTGGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929686553 2:44040049-44040071 TGGCCTGAACCAGTGATGGAGGG + Intergenic
929873003 2:45774054-45774076 TGAACAGCAGCAGCGGGGGAGGG - Intronic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931179059 2:59881719-59881741 TGTCCAGCAGGACTGATGGAAGG - Intergenic
931470186 2:62531755-62531777 TGGCCTGCTGCAGTGGTTGGTGG + Intergenic
931812904 2:65872416-65872438 AGGTCAGCAGCAGTAGTGTACGG + Intergenic
932134583 2:69217259-69217281 TGGCCAGCAGCAGGGATGGGAGG - Intronic
932305915 2:70704279-70704301 CTGCCAGGAGCAGAGGTGGAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933644349 2:84798618-84798640 GGGCCTGTAGCAGTGGTGGTGGG - Intronic
934696009 2:96400611-96400633 TGTCCACCAGCATTGGTGGGGGG - Intergenic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935784484 2:106536310-106536332 TGGCCAGGCGCAGTGGTTCATGG - Intergenic
936050450 2:109218661-109218683 CGGCCAGCAGGAGTGAGGGAGGG + Intronic
936529653 2:113267264-113267286 TGGGCAGCAGCAGTAGCGGCAGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
936965746 2:118126110-118126132 TGGTCAGCAGGGGAGGTGGAGGG - Intergenic
937198291 2:120179889-120179911 TGGGCAGCAGTGGAGGTGGAGGG + Intergenic
937198327 2:120180054-120180076 TGGCCAGCACCAGGCCTGGAGGG + Intergenic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
937826481 2:126372964-126372986 CTTCCAGCAGCGGTGGTGGATGG - Intergenic
938669792 2:133575727-133575749 TGGCCAGCAGCAGTAGGAGAGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940271599 2:151896987-151897009 TGCCCAGCAGAAGTGTTGGTAGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941285797 2:163610954-163610976 TAGCCAGGAACAGTGGTGGGGGG + Exonic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943290073 2:186059334-186059356 TTGCCATCAGCCGGGGTGGAAGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946596339 2:221309818-221309840 TGTGCAGCAGCAGTGGTGCACGG - Intergenic
948890703 2:240905731-240905753 TGGTCAGCATGCGTGGTGGAGGG - Intergenic
1170430383 20:16270384-16270406 TGGGGAGCAGCTGTGGTGCAGGG - Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171502337 20:25603537-25603559 TGGTGAGAACCAGTGGTGGAGGG + Intergenic
1172388901 20:34552842-34552864 TGTGGAGCAGGAGTGGTGGAAGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173742059 20:45407999-45408021 TGGGCTGCAGCACTGGAGGAAGG + Exonic
1173974306 20:47175474-47175496 TGCCCAGCATCATTGGTAGATGG + Intronic
1174619036 20:51859902-51859924 TGGACAGCTGCAGGGATGGAGGG + Intergenic
1174940358 20:54919896-54919918 TGGTCACCAGCAGAGGTAGATGG + Intergenic
1175331514 20:58167995-58168017 TGCCCAGCAGGAGGGGTGCATGG + Intergenic
1176204026 20:63878534-63878556 TGGGCTGCAGCAGTGGGGGCAGG - Intronic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1177245046 21:18512362-18512384 TGGGCAGCAGGAGTGATTGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177638409 21:23815556-23815578 TGGCCAGCAGCAGGGGTGACAGG + Intergenic
1177757057 21:25360732-25360754 TGGGCTGCAGCAGTGATGAAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178875822 21:36413170-36413192 TTGACAGCAGGAGTGATGGAGGG - Exonic
1178900804 21:36596989-36597011 TGGCAGGCAGCGGGGGTGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179327874 21:40367294-40367316 GGACCAGCAGCAGAGGTGGAAGG - Intronic
1179544920 21:42107500-42107522 TGGCCAGCAGGTGAGGGGGATGG - Intronic
1181144320 22:20833448-20833470 TTGGCAGTAGCAGTGGTGCACGG + Intronic
1182019295 22:27067499-27067521 TGGCCAGCAGCTGGGATAGATGG - Intergenic
1182247674 22:28972718-28972740 TTGCCATCAGCAGTGTTTGAGGG + Intronic
1182349637 22:29692092-29692114 GGGCGAGCAGCAGTGGCCGAAGG + Intronic
1183933556 22:41249340-41249362 ACGCCAGCAGCAGGGGTGCAAGG + Exonic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
1185309154 22:50144139-50144161 AGGTCAGCAGCACTGTTGGAGGG - Exonic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950534167 3:13569757-13569779 TGGCCAGCAGCTGTGGTGCGTGG + Intronic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
950841711 3:15974310-15974332 TGGCCAGAAGCAGAGGTAGAGGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953701364 3:45198416-45198438 TGGCCAGGAGGAGGGGTGGCTGG + Intergenic
953853131 3:46480990-46481012 TGCCTATCAGCAGTGGAGGAGGG - Intronic
954122496 3:48507702-48507724 TGGCCACCAGCTTTGATGGAGGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955774664 3:62420547-62420569 TGGCAGGCAGCACAGGTGGATGG + Intronic
956304572 3:67809738-67809760 TGGACACCTGCAGTGGTGGGAGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962903591 3:139781542-139781564 ATTCCTGCAGCAGTGGTGGAGGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963068306 3:141281363-141281385 TGGGCTGGAGCAGTGATGGAGGG + Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966931895 3:184680830-184680852 TGGGCTGCAGGAGTGGTGGGGGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967160838 3:186736534-186736556 GGGACAGCAGCAGTGGTGGTAGG - Intronic
968108029 3:196016618-196016640 CTGCCAGGAGCTGTGGTGGAGGG - Intergenic
968278634 3:197459287-197459309 TGGCCAGCACTGTTGGTGGAAGG - Intergenic
968359445 3:198137080-198137102 TGTTCAGCAGCAGTGGGAGAGGG - Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968871178 4:3243339-3243361 TGGCCAGCAGCTGTGGTCCCGGG - Exonic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969366358 4:6696812-6696834 TGCCCAGCAGCAGTGCTTGGTGG + Intronic
969602111 4:8182690-8182712 TGGCCAGCAGCCATAGTTGATGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970400191 4:15709740-15709762 GGGCCAGCAGCAATGGTGATGGG + Intronic
970718316 4:18955275-18955297 TGAGAAGCAGCAGTGGTAGAAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974926555 4:68305966-68305988 TTGCCACCAGCAGGGGTGGTGGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975622833 4:76310915-76310937 TGGCCAGATGCGGTGGGGGAGGG - Exonic
976129539 4:81870389-81870411 ATGCCAGCTGCAGTGGGGGAGGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976783252 4:88785905-88785927 TGACCAGGAGGAGTGGTGAAGGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977919114 4:102624348-102624370 TCGCTGGCAGCAGTGGTGGAGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978758608 4:112330830-112330852 TGGCCAGAGGCAGTGTTGTATGG + Intronic
978832242 4:113102170-113102192 TGGTGAGCAGCAGCGGTGGCTGG + Intronic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981542820 4:145863280-145863302 TGCCCACCAGCAGTGGATGAGGG - Intronic
981742981 4:148022455-148022477 GGGCCTGCAGCATTGCTGGAAGG + Intronic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982265320 4:153533368-153533390 TCTGCAGCAGCAGTGGCGGAGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983547002 4:168975552-168975574 TTGCCAGCTGCAGTAGTAGAAGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984644058 4:182201621-182201643 TGGCCAGCAGGAGCAGCGGAAGG + Intronic
985512799 5:321745-321767 TGGCCAGGAGCTGTGGCGGCGGG - Intronic
985514465 5:333448-333470 TAGCCAGGAGTGGTGGTGGAGGG + Intronic
985655413 5:1129210-1129232 GGGCCGGCAGCAGTGGCGGCTGG - Intergenic
985703049 5:1385156-1385178 TGGCCAGCAGCCATGGCTGAGGG + Intergenic
985759078 5:1735564-1735586 TGGTCAGCAGCAGGGGTGCCTGG + Intergenic
986074941 5:4326839-4326861 TGGAGGGCAGCAGAGGTGGAGGG - Intergenic
986074949 5:4326869-4326891 TGGAGGGCAGCAGAGGTGGAGGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987993035 5:25239866-25239888 TGGCCAGGAGCAGTGGTTCACGG - Intergenic
988487337 5:31677874-31677896 AGGACAGCAGCAGAGGAGGAAGG + Intronic
988513416 5:31884786-31884808 TAGCCAGGAGTGGTGGTGGATGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990440339 5:55838639-55838661 TGTCCAGTATGAGTGGTGGATGG - Intergenic
990881865 5:60547701-60547723 TGGCCGCCACCAGTGGTGTATGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994678360 5:102854056-102854078 TTGCCAGCAGTAGTGGGGCAGGG - Intronic
995229636 5:109744468-109744490 TAGACAGCAGCAGTTGGGGAGGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997065786 5:130556949-130556971 TGAAGAGCAGCGGTGGTGGAGGG - Intergenic
997207926 5:132060889-132060911 TGGCCTGCAGCAGTGAGGGGTGG + Intronic
997521789 5:134527756-134527778 AGGCCAGCGGCAGTGGCTGAGGG - Intronic
998040355 5:138947477-138947499 TGGCCTGCGGCTGTGGCGGATGG - Intronic
999653772 5:153793313-153793335 TGGCAAGGAGCACTGATGGAAGG - Intronic
1000266718 5:159645093-159645115 TGGAAAGCAGCAGGGGTGGGGGG + Intergenic
1000326948 5:160179426-160179448 TGCCCAGCAGGAGAGGGGGATGG + Intergenic
1001439964 5:171735190-171735212 GAGCCAGCAGCCTTGGTGGATGG + Intergenic
1002496339 5:179614850-179614872 TGTCCAGTATGAGTGGTGGATGG - Exonic
1002602434 5:180361711-180361733 TGGCCAGGAGCCCTGGGGGAAGG + Intergenic
1003151056 6:3549212-3549234 TGGCCAGCAGAGTTGGAGGATGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005704165 6:28435158-28435180 TGGCCAGGAGAATGGGTGGAAGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005899715 6:30206884-30206906 TGCCCAGCAGCAGAGCTGGCTGG + Intronic
1005939294 6:30548667-30548689 TGCCCAGGAGCAGTGCTGAATGG - Intronic
1008092179 6:47305165-47305187 TGGCCATCACCAGTGCTGGTTGG - Intronic
1008132067 6:47729889-47729911 TGGACAGCAGCAGCAGGGGATGG - Intergenic
1008132932 6:47739140-47739162 TGGTGAGCAGCAGTGATGGTGGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012848817 6:104423429-104423451 TGACAAGCAGAAGTGATGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014947532 6:127515874-127515896 GGGGCGGCAGCGGTGGTGGAGGG - Exonic
1015208751 6:130671906-130671928 TTGCCAGCACCAGTGGGGTAAGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016108533 6:140192007-140192029 TGGCTAATAGCAGTTGTGGAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018710718 6:166496670-166496692 TGGCCCGCAGTACTGCTGGATGG + Intronic
1018801938 6:167229705-167229727 TGGCTAGCAGTAGTTATGGAGGG + Intergenic
1019141910 6:169953437-169953459 TGGTCAGAAGCAGTGCTGTATGG - Intergenic
1019372997 7:673111-673133 TGGCCAGCAGCTGTGGACCAGGG + Intronic
1019451485 7:1100934-1100956 AGGCCAGGAGCAGGGGTGCACGG - Intronic
1019695934 7:2446170-2446192 GAGCCAGCAGCAGGGCTGGAAGG + Intergenic
1019730043 7:2624493-2624515 AGGCCAGCAGCGGGCGTGGAGGG - Intergenic
1019922439 7:4171640-4171662 TGGCCACCACCAGTGGATGAGGG - Intronic
1020274726 7:6617089-6617111 TGGCCCGAGGCAGAGGTGGAGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021481416 7:21121962-21121984 TGCCCAGCATCAGTGGTAAATGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021899953 7:25275337-25275359 TGGCCTGCAGCAGAGTTGGGGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024853144 7:53744543-53744565 GGGCTAGCAGCAGTGGTGGTGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026455363 7:70567680-70567702 TGGCCAGCAGCAATGGCGTAGGG + Intronic
1026553531 7:71387469-71387491 TAGCCAGGTGCAGTGGTGCATGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029503190 7:100946495-100946517 TGGACAGAAGGGGTGGTGGATGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035017383 7:155778593-155778615 TGGCCTGGAGGAGTGGGGGAGGG + Exonic
1035330660 7:158095013-158095035 GGGCCAGCATCCGTGGTGGGAGG + Intronic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1040891933 8:52326254-52326276 TGGCCTGCAGCAGTGGGGAAGGG + Intronic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042063845 8:64851381-64851403 TAACCAGCAGTTGTGGTGGAAGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044487053 8:92766392-92766414 TGGACAACAGCAGAGGTGGCTGG + Intergenic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045586562 8:103544397-103544419 TGGCTACCAGCAGTGGAGGTGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046503885 8:115112062-115112084 ATGCCAGCTGCAGTGGGGGAAGG - Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047995280 8:130329162-130329184 GAGGCAGCAGCAGTGGTTGAGGG - Intronic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048563837 8:135572595-135572617 AGACCAGCAGCAGTGCTTGAGGG + Intronic
1048938442 8:139376229-139376251 TGGCCTGAAGCAGTGCTGCAGGG + Intergenic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1049618596 8:143587803-143587825 TGGCCAGCAGCAGAGGAGCTGGG + Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050537758 9:6645374-6645396 GGGACAGCAGCAGTGGCGGCGGG - Exonic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056338483 9:85601245-85601267 AGGGCAGCAGCAGTGCTGGTGGG - Intronic
1056556923 9:87697288-87697310 AGGCCAGCAGCAGCAGTGGCAGG - Intronic
1056852012 9:90092975-90092997 GGACCAGCAGCAGAGGAGGAGGG + Intergenic
1059179743 9:112200613-112200635 TGGCCAGCTGCAGGGGAGGCTGG - Intergenic
1059634554 9:116158123-116158145 TGGCAAGCAGAGGTGCTGGATGG - Intronic
1060010377 9:120038549-120038571 TGGCTGGCTGCAGTGGTGGGTGG - Intergenic
1060211567 9:121713571-121713593 TGGCCAGTAGTGGTGGTGCAGGG + Intronic
1060220247 9:121760704-121760726 TCCTCTGCAGCAGTGGTGGAAGG - Intronic
1060800575 9:126542547-126542569 TAGCCAGGCGCAGTGGTGGGTGG + Intergenic
1060904043 9:127288455-127288477 TGGAGAGGAGCAGTGGTAGATGG + Intronic
1061266415 9:129507868-129507890 TGGCCAGCAGCAGAGGGGCCAGG - Intergenic
1061684201 9:132261147-132261169 CTGCCAGAAGCACTGGTGGAGGG - Intergenic
1061726271 9:132583553-132583575 TGTCCACCAGCACTGCTGGAAGG - Intronic
1062106023 9:134755390-134755412 TGGCCAGCTGCAGAGTTGCATGG + Intronic
1062432130 9:136530954-136530976 TGTTCAGGAGCAGTGGTGGGAGG - Intronic
1062674429 9:137732129-137732151 TGGCAAGCAGCAGTGGAGCCAGG - Intronic
1062744133 9:138200794-138200816 TGTTCAGCAGCAGTGGGAGAGGG - Intergenic
1203782751 EBV:109924-109946 TGGCCGGCATCTGAGGTGGACGG + Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186644628 X:11493497-11493519 AAGCCAGCAGGAGTGGTGGTAGG + Intronic
1187701510 X:21968168-21968190 TGGCCAGCAGCAGTGCTGCAGGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189235501 X:39483944-39483966 TGGCCAGCTGATGTGGTGGCTGG - Intergenic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1191040135 X:56069540-56069562 TGGCTACCAGCAGTGGGGGTGGG - Intergenic
1191080297 X:56503895-56503917 TGGCCAGAAGCACTGGTAAAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193328354 X:80207807-80207829 TGGCAAGGAGCAGTGGAGGTAGG + Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1193582956 X:83287140-83287162 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1193797718 X:85897367-85897389 TTGCCAGCAGCAGTGGGGAGAGG + Intronic
1195146855 X:102026835-102026857 GAGCCAGCAGCAGTGGTGATGGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196008787 X:110864242-110864264 AGGCCATCAGCATTGTTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198343053 X:135733345-135733367 TTCCCAGCAGCAATGGTGGAGGG - Intergenic
1198344936 X:135749950-135749972 TTCCCAGCAGCAATGGTGGAGGG + Intergenic
1198784692 X:140274108-140274130 TTGGCAGCAGCAGAGATGGATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200180436 X:154147202-154147224 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1200186264 X:154185597-154185619 GTCCCAGCAGCAGTGGGGGAGGG - Intergenic
1200191916 X:154222735-154222757 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1200197671 X:154260539-154260561 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1202378673 Y:24258978-24259000 TGGCCAGCCGCAGTCTTGGCCGG - Intergenic
1202492109 Y:25411143-25411165 TGGCCAGCCGCAGTCTTGGCCGG + Intergenic