ID: 965347940

View in Genome Browser
Species Human (GRCh38)
Location 3:167575325-167575347
Sequence CTGCTTCTTCATTGAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965347933_965347940 23 Left 965347933 3:167575279-167575301 CCAAGAAGGGCTGTGGTCTGCGC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 965347940 3:167575325-167575347 CTGCTTCTTCATTGAGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 197
965347932_965347940 26 Left 965347932 3:167575276-167575298 CCTCCAAGAAGGGCTGTGGTCTG 0: 1
1: 0
2: 1
3: 16
4: 202
Right 965347940 3:167575325-167575347 CTGCTTCTTCATTGAGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965347940 Original CRISPR CTGCTTCTTCATTGAGATGC AGG Intronic
903024397 1:20417161-20417183 CTGCTTCTTCATTCAAAAACAGG + Intergenic
904165663 1:28553284-28553306 CAGCCTCTTCACTTAGATGCTGG - Intronic
906508413 1:46396732-46396754 ATTCTTCTGCCTTGAGATGCTGG - Intronic
908123209 1:61005131-61005153 TTTCTTCTGCATTGAAATGCAGG - Intronic
909855070 1:80519149-80519171 CTGCTTGATCATTGTGATGCAGG - Intergenic
914355638 1:146881985-146882007 CTGCTTCTTGGTTCAGATCCTGG - Intergenic
916743053 1:167663002-167663024 CTGCTTCATCTGTGAGATGAGGG - Intronic
917685484 1:177411633-177411655 CTGCACATTCACTGAGATGCTGG - Intergenic
919047521 1:192472111-192472133 ATTTTTCTTTATTGAGATGCTGG + Intergenic
920230566 1:204467077-204467099 CCGCTTCTTCAAGGAGATTCTGG + Intronic
921742681 1:218704467-218704489 CTGCTTTTTCAGTGAAATGAAGG - Intergenic
921827065 1:219684463-219684485 CTGTATCTTAATTGAGATGGTGG - Intergenic
924918535 1:248600762-248600784 CTGCTTCTTTATTGATTTGTAGG + Intergenic
1063010296 10:2014993-2015015 CTGCATCTCCATTGGGAGGCAGG + Intergenic
1063099153 10:2934710-2934732 GTGCCTCTTCATAGAGATCCTGG + Intergenic
1064936677 10:20686196-20686218 CTGATTCTTTATTGAGAAGGGGG - Intergenic
1069025588 10:63537462-63537484 CTGCTTCTTAAGTTGGATGCCGG + Intronic
1069585313 10:69596561-69596583 CTGCTTCTGCTCTGAGTTGCAGG + Intergenic
1069842466 10:71348389-71348411 CTGCTTCTTTTTAGAGATGAAGG + Intronic
1070011783 10:72482671-72482693 CTGCTTCTTCATTTATATGATGG + Intronic
1072259060 10:93649966-93649988 CTGCATCTTGATTGTGGTGCTGG - Intronic
1073213639 10:101824381-101824403 CTGCTTCTTCTATGAAATGGAGG + Intergenic
1077755534 11:5024444-5024466 CTGCTTATTCATGTAGATCCTGG + Intergenic
1079606815 11:22379925-22379947 CTGTTTCTTCATTTACAAGCTGG - Intergenic
1080474002 11:32572894-32572916 CTGCTTGTTCATGGAGCTTCTGG + Intergenic
1087872770 11:103318225-103318247 CTGTTTCTTGATTAAGGTGCTGG - Intronic
1087893122 11:103557588-103557610 CAGATTCTTCATTCATATGCAGG - Intergenic
1090456711 11:126856293-126856315 TTGCTTCTGCATTGAAATGTTGG + Intronic
1091772228 12:3159693-3159715 CAGTTTCTTAATTGAGATGAGGG - Intronic
1091873664 12:3916087-3916109 CTGCTTCTTTCTGGAGAGGCAGG + Intergenic
1092106847 12:5927437-5927459 CTGTTTTTTCATTGAGATTTGGG - Intronic
1093089604 12:14906265-14906287 GTGCTTCAGCATTTAGATGCAGG + Intronic
1095498406 12:42809661-42809683 CAACTTATTCATTGAGATTCTGG - Intergenic
1097449069 12:59713781-59713803 TTTCTTCTTAATTGTGATGCTGG - Intronic
1098167739 12:67715434-67715456 CTGCCTCTTCCTCGAGTTGCTGG + Intergenic
1099858290 12:88198225-88198247 CTGCCTGTTCAGTGAGATGGAGG + Exonic
1100536690 12:95518183-95518205 CAGCGTCTTCATTGGGATGTTGG + Exonic
1101284249 12:103293764-103293786 CTACGTCTTCATTGAAATACAGG + Intronic
1104152028 12:126093036-126093058 ATGCCTCTTAATTGAGATGAAGG + Intergenic
1104502527 12:129300174-129300196 CAGCTACTTAATTAAGATGCAGG + Intronic
1105744671 13:23366046-23366068 CTGATTCTTGATTCAGATTCTGG - Intronic
1107749720 13:43552038-43552060 CTGCTTCTTCCTGGAGAGGTTGG - Intronic
1108756263 13:53505969-53505991 CTGCCTGTTCAGTGAGATGGAGG + Intergenic
1111798523 13:92954358-92954380 TTGCTGCTTCATTAATATGCTGG + Intergenic
1113668908 13:112161942-112161964 CTGCTTCTTCCATGAGAAACAGG - Intergenic
1117276728 14:54201678-54201700 CTTCTTCTACAATGAGATACTGG + Intergenic
1119058764 14:71452121-71452143 CTGATTTTTAATTGTGATGCTGG - Intronic
1119613421 14:76082703-76082725 CAGCTTCTGCATAGAGAGGCGGG + Intronic
1120905114 14:89613435-89613457 CTCATTCTTCTTTGAAATGCAGG + Intronic
1120973149 14:90226374-90226396 AGCCATCTTCATTGAGATGCTGG + Intergenic
1121582706 14:95042961-95042983 CTGTATCTTGATTGTGATGCTGG + Intergenic
1125065223 15:35475048-35475070 GTGCTTCATTATTCAGATGCAGG - Intronic
1127404395 15:58626062-58626084 CTGATTCTTGATTGTGATGGTGG + Intronic
1129026111 15:72575870-72575892 TTGTTTTTTCATTGAGATGAGGG + Intronic
1131556967 15:93408053-93408075 ATGCTTCTTCATAGAGGTGAAGG - Intergenic
1140145824 16:72307398-72307420 CTACTTCTTGATTGAGGTGGTGG + Intergenic
1140165597 16:72547341-72547363 CGGCTTCATCCTTGGGATGCAGG + Intergenic
1141262545 16:82467092-82467114 ATGGTTCTTCATTTGGATGCTGG + Intergenic
1143977753 17:10842914-10842936 TTGCTTCTCCCTTGTGATGCTGG + Intergenic
1145013089 17:19380956-19380978 CTGCATCTTTGGTGAGATGCTGG + Exonic
1147889052 17:43704462-43704484 CTGCTTCTTCCTTAGGCTGCTGG + Intergenic
1147970282 17:44215746-44215768 CCGCTTCTTCATGGAGAAGCGGG - Exonic
1150136167 17:62696505-62696527 CTGCCCCTTCAGAGAGATGCAGG - Intergenic
1150228009 17:63534242-63534264 CTGGTTCCTCATTGACATGGTGG + Exonic
1150535083 17:66029969-66029991 CTGCTTCTCCAGTCAGCTGCTGG + Exonic
1150689047 17:67347726-67347748 CTGTGTCTTCATTGTGATGATGG - Intronic
1151032170 17:70754186-70754208 CTGCTTGTCAATTGAGATGGTGG + Intergenic
1152963000 18:91080-91102 ATTCTTCTGCTTTGAGATGCTGG - Intergenic
1155400366 18:25432421-25432443 TTCCTTCTTCATTTAGTTGCTGG - Intergenic
1156831956 18:41502536-41502558 GTGCCTCTCCATTGACATGCAGG - Intergenic
1157230592 18:45912109-45912131 CTGGATCTTTATTGAGTTGCTGG - Intronic
1157300799 18:46477660-46477682 CCGCTTCTTCCTGGAGACGCTGG - Exonic
1158232017 18:55267238-55267260 CTGTTTGTTCTTTGAGATACAGG + Intronic
1158880221 18:61771316-61771338 CTGTGTCTTCATTGTGATGGTGG - Intergenic
1159409707 18:68055243-68055265 CTGCTTCCTCCTGGTGATGCTGG - Intergenic
1161166012 19:2787914-2787936 CTCTTTCTGCAGTGAGATGCAGG - Intronic
1163578477 19:18124100-18124122 CCGCTACTTCCTAGAGATGCAGG + Exonic
1165198994 19:34130183-34130205 GTGCTTCTTCATAGGGCTGCAGG + Intergenic
1165221231 19:34318179-34318201 CTGTTTCTTCTTGGAGAAGCAGG - Intronic
1165334287 19:35158110-35158132 CAGCTCCTTCTTCGAGATGCTGG - Intronic
1166185246 19:41135267-41135289 CTCCTTCCTCCCTGAGATGCGGG - Intergenic
1166710128 19:44931514-44931536 CTGCTTCTTCACTGTGGGGCAGG + Intergenic
1167057629 19:47122252-47122274 CTGTTTCTTGATTTAGCTGCTGG - Intronic
1167213059 19:48145642-48145664 CTGCTGCCTCATTGTAATGCCGG - Intronic
925618882 2:5770829-5770851 CTCCTTCTTCATTGAGCAGCTGG + Intergenic
926000589 2:9329042-9329064 CTGTTTCTTGAATGAGCTGCAGG + Intronic
926832539 2:16979259-16979281 ATGCTTCTACATGGAGAAGCTGG + Intergenic
927482628 2:23466482-23466504 CTGCTTCTTCTTTTATATGTGGG - Intronic
928193645 2:29196854-29196876 GTGCTTCTTCTTTTAGATACCGG - Exonic
928306186 2:30172175-30172197 CTGCTCCATCAGTGAGCTGCTGG + Intergenic
929580446 2:43078867-43078889 CTGGTCCCTCATAGAGATGCTGG - Intergenic
931647652 2:64439523-64439545 CTGCTTCTACCCTGAAATGCAGG - Intergenic
936816212 2:116464116-116464138 CTTCTTTTTCACTGAGCTGCTGG + Intergenic
937825115 2:126360441-126360463 CTGTTTCCTCATTGGCATGCTGG - Intergenic
937825183 2:126361182-126361204 CTGTTTCCTCATTGGCATGCTGG + Intergenic
938009608 2:127818526-127818548 CTGCTTCTGCAATGAAGTGCAGG - Intergenic
940578368 2:155544525-155544547 CTTATTTCTCATTGAGATGCCGG - Intergenic
947206640 2:227667077-227667099 CTGCTTCTGGACTGAGGTGCGGG + Intergenic
948754140 2:240149466-240149488 CTGCTTCCTCACTGCGGTGCAGG + Intergenic
948967783 2:241397690-241397712 CAGCTGCTTCATTGAGTTGTAGG + Intronic
1169153069 20:3305763-3305785 CTGGTTCTTCCATGAGAGGCAGG - Intronic
1171849008 20:30294983-30295005 GTGCTTCTCGATTGAGAGGCTGG - Intergenic
1172011277 20:31847290-31847312 CTGCCTCTTCAGTGAGGGGCAGG + Intergenic
1174085992 20:48007435-48007457 CTGCTTCCTAATAGAGAGGCTGG + Intergenic
1174529656 20:51200970-51200992 CTACATCTTGATTGAGATGATGG - Intergenic
1177295235 21:19165161-19165183 CTACTTCTTCATTGATAGGATGG + Intergenic
1177765025 21:25448322-25448344 CTGCCACTTCACTGTGATGCAGG - Intergenic
1182020834 22:27080318-27080340 CAGCTGCCTCATTGAGATTCAGG - Intergenic
1182301509 22:29339768-29339790 CTGCTTCTGCTTGGAGATGGGGG - Exonic
1182674305 22:32026044-32026066 CTACATCTTGATTGAGATGGTGG + Intergenic
1183675411 22:39296539-39296561 CTGCTTCTACAGGGAGATGGGGG - Intergenic
1184693306 22:46127188-46127210 CTGCTTCTTCCTTCAGGTGGAGG - Intergenic
949730918 3:7111863-7111885 CTTCTTCTTGATTCAGATGTTGG - Intronic
950366395 3:12488067-12488089 CAGCTTCTTCCTTGAGAAGTTGG + Intronic
951824616 3:26854597-26854619 CTGCTTCTTAATTTGGGTGCTGG - Intergenic
952842822 3:37662597-37662619 CTGCTCCTGCACTGAGATGAAGG - Intronic
954050613 3:47973343-47973365 CTGCCTCACCATTGAGATACTGG + Intronic
956023212 3:64954494-64954516 CTGCTTCTTGATCTGGATGCTGG + Intergenic
956565319 3:70630666-70630688 CTGCTTCTTCATTCTGATGCTGG - Intergenic
957106177 3:75890639-75890661 GTGCTTTTTCATTGAAATGGAGG - Intergenic
957574813 3:81993629-81993651 CTGCTTCTCCCTGTAGATGCTGG - Intergenic
961538543 3:127585188-127585210 CTGCTTATTTATTGAGATCTCGG - Intronic
962869440 3:139475398-139475420 CTCCTTTTTCATTGACATGGTGG + Intronic
963551465 3:146729288-146729310 CAGCTTCATCCCTGAGATGCAGG + Intergenic
964475024 3:157090352-157090374 CTGCTTCTTCTTTAATATGAGGG - Intergenic
965347940 3:167575325-167575347 CTGCTTCTTCATTGAGATGCAGG + Intronic
965613840 3:170572785-170572807 CTTCCTCTGCATTGTGATGCTGG + Intronic
965756667 3:172034512-172034534 CTTCTTCTTCCATGAGAAGCTGG - Intergenic
966084590 3:176054248-176054270 CTGTTTATTCATCTAGATGCTGG + Intergenic
966133918 3:176676634-176676656 CAGCTTCATCTGTGAGATGCAGG + Intergenic
967439212 3:189487621-189487643 CTGTTTCTTGATTTGGATGCTGG + Intergenic
967741617 3:193009400-193009422 TTGCTTCTTCCTTGAGATTTTGG + Intergenic
968760345 4:2439678-2439700 CTGCTTTTTCATTAAAATGAAGG - Intronic
971496122 4:27267261-27267283 CTCCTTCTCCACTGAGATGATGG - Intergenic
973702051 4:53546996-53547018 CTGCCTCTTCAGTGAGAGGGAGG + Intronic
974092753 4:57329294-57329316 CTGCTTCTTCACTCAGACGAGGG + Intergenic
974372548 4:61036614-61036636 CAGATTCTGCAATGAGATGCTGG - Intergenic
975494730 4:75025101-75025123 CTCATTGTTCATGGAGATGCTGG + Intronic
975886262 4:78969027-78969049 CTGTTTCTTCATTGATCTACTGG + Intergenic
976915546 4:90369800-90369822 CTGCTGTTTCTTTGAGATACTGG + Intronic
977301559 4:95273552-95273574 TTGCTTCTTCAGGGAGATGGGGG + Intronic
978357391 4:107891648-107891670 CTGCTTCCTCAGTGAAATGCAGG + Intronic
979098275 4:116578574-116578596 TTGCATCCTCATTGAGCTGCAGG - Intergenic
982433099 4:155346309-155346331 CTGCTTGTTCTTAGAGATGGTGG - Exonic
982548551 4:156766238-156766260 TTGTATCTTCATTGAAATGCTGG - Intronic
985525985 5:401993-402015 CTGCCTCTTCATTGTGTTGACGG - Intronic
988300938 5:29425928-29425950 CTGCATCTTTATTTTGATGCTGG + Intergenic
992361881 5:76047189-76047211 CTGCTTCTTAATTTAGGTGCTGG - Intergenic
994986586 5:106941273-106941295 CTGCTTATTCTTCAAGATGCAGG + Intergenic
996417798 5:123228751-123228773 TTGCTGCTTCATTCTGATGCAGG + Intergenic
997951899 5:138249128-138249150 CTGCTTCTTCATTAAAACGATGG + Intergenic
999141109 5:149362751-149362773 CTGCTTGTTGACTGAGATGGTGG - Exonic
999426767 5:151494385-151494407 CTGTATCTTGATTGAGATGGTGG - Intergenic
1000235450 5:159355369-159355391 CTTCTTCTTCATTGATCTACTGG + Intergenic
1001296284 5:170501582-170501604 CTGCTTCTTCAGTGGGTTGTGGG + Intronic
1007382638 6:41500652-41500674 CTGCTTCTTCTTTCAGCTGGGGG - Intergenic
1007434955 6:41803866-41803888 GTGCTTGCTCACTGAGATGCTGG - Exonic
1008317014 6:50056440-50056462 CTGCTTCTACCTTGACATTCTGG - Intergenic
1008960988 6:57265157-57265179 CTGCTTCTCCATAGACATCCAGG - Intergenic
1009004178 6:57761835-57761857 CTGCATCTTTATTTTGATGCTGG + Intergenic
1010648483 6:78423039-78423061 TTGCTCCTTCAGTGTGATGCTGG - Intergenic
1015464097 6:133528633-133528655 CTGCTGCTTCATTGAGACAATGG + Intronic
1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG + Intronic
1018703326 6:166445309-166445331 TTTCTTCTTCATTGAGTTTCTGG - Intronic
1020361942 7:7336211-7336233 CTCCTTTTTCATTGAGAAGGAGG - Intergenic
1020921226 7:14267316-14267338 CTTCTTCTTCATGTAGATTCAGG - Intronic
1022033226 7:26511326-26511348 CTGTTTCTTGATTGGGATGATGG + Intergenic
1022537874 7:31109153-31109175 CTGCATCCTCATAGAGGTGCCGG + Exonic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024501348 7:50111298-50111320 CTGCTTCTGCAGTGAAATGCAGG + Intronic
1026922390 7:74165755-74165777 CTGTGTCTTGATTGAGATGCTGG + Intergenic
1028329268 7:89568484-89568506 TTGCCCCTTCATTAAGATGCTGG - Intergenic
1028924607 7:96344334-96344356 CTGCATCTTGATTGAGGTGGAGG - Intergenic
1030157044 7:106465835-106465857 GTGCTTCTTCATTTAGACCCAGG - Intergenic
1030375269 7:108746274-108746296 CTGCTTCTCCATAGAGCTGCTGG + Intergenic
1030553675 7:110996444-110996466 CAGCTTCTTCATTGGAATGATGG - Intronic
1031507453 7:122603607-122603629 CTGTTTCTTCATTGGTATGAAGG - Intronic
1032744762 7:134774485-134774507 CTGATTCTTCTTTGAAGTGCTGG - Intronic
1034885676 7:154796682-154796704 ATGCTTCTTCATCGATATGGTGG + Intronic
1035601085 8:897146-897168 CTGATGTTTCATGGAGATGCTGG + Intergenic
1037245930 8:16834929-16834951 TTGCTTTTTTATTGAGATGAAGG - Intergenic
1037616511 8:20523966-20523988 CTGCATCTTTATTGAGGTACAGG + Intergenic
1038369786 8:26977211-26977233 CTGTTTCTTCATTGTGAGGGTGG - Intergenic
1039833433 8:41236204-41236226 CCGCTTCTTCATTGGTATGAAGG + Intergenic
1040904832 8:52457170-52457192 TTGTTTATTCATTGAGATGTGGG - Intronic
1041282591 8:56226316-56226338 CTGCTTCTGCATTTTCATGCAGG - Intergenic
1045625298 8:104039757-104039779 CTTATTCTTCTTTGAGAAGCAGG + Intronic
1049923905 9:390545-390567 CTGGTTCTTCTTTGAGCTTCTGG + Exonic
1050023215 9:1306679-1306701 CTCCTTCTTCATTGCCATGGAGG - Intergenic
1051825030 9:21210628-21210650 CTGCTTCTCCGTAGAGCTGCTGG - Intronic
1052427144 9:28320186-28320208 CTGCTTCTTCTTGGAAATGATGG - Intronic
1053599359 9:39594351-39594373 CTGTATCATCATTGAGATGCAGG + Intergenic
1053786728 9:41657702-41657724 GTGCTTCTCTATTGAGAGGCTGG - Intergenic
1053857064 9:42348537-42348559 CTGTACCATCATTGAGATGCAGG + Intergenic
1054158333 9:61656493-61656515 GTGCTTCTCGATTGAGAGGCTGG + Intergenic
1054254165 9:62748035-62748057 CTGTACCATCATTGAGATGCAGG - Intergenic
1054478106 9:65587498-65587520 GTGCTTCTCGATTGAGAGGCTGG + Intergenic
1054568230 9:66782205-66782227 CTGTACCATCATTGAGATGCAGG - Intergenic
1055428292 9:76218023-76218045 CTGCTTCTTCACTGAGTGGGTGG - Intronic
1061267857 9:129518428-129518450 AGGCTTTTTCATTGAGATCCTGG - Intergenic
1062735145 9:138133041-138133063 ATTCTTCTGCTTTGAGATGCTGG + Intergenic
1186871821 X:13781256-13781278 CTGCTTCCTCAGTGAGTTCCTGG + Intronic
1188543595 X:31276962-31276984 CTGTTTCTTTATTTGGATGCTGG + Intronic
1189961157 X:46326113-46326135 CAGCCTCTTCAATGAGATGCAGG + Intergenic
1192489880 X:71566725-71566747 GTACCTCTGCATTGAGATGCAGG - Intronic
1195955618 X:110326654-110326676 CTGTTTCCTTATTGAGGTGCAGG + Intronic
1196211248 X:112998133-112998155 TTGCTTGTTCATTGACAAGCAGG + Intergenic
1196739178 X:119009452-119009474 ATGCTTCTTCAGTGGTATGCTGG - Intronic
1198493042 X:137163015-137163037 CTGCTTCTTTATTTAGATAATGG + Intergenic
1199849573 X:151715759-151715781 CTGTTTCTTCATAGAAATGATGG + Intergenic